Incidental Mutation 'R8737:Or10a3m'
ID 663094
Institutional Source Beutler Lab
Gene Symbol Or10a3m
Ensembl Gene ENSMUSG00000056946
Gene Name olfactory receptor family 10 subfamily A member 3M
Synonyms Olfr512, MOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission 068584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 108312562-108313542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108312964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 135 (F135I)
Ref Sequence ENSEMBL: ENSMUSP00000074291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
AlphaFold Q8VFZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000074730
AA Change: F135I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: F135I

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209620
AA Change: F123I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,308,810 (GRCm39) D375V probably damaging Het
Agfg1 C G 1: 82,871,243 (GRCm39) P492A probably benign Het
Asb13 T C 13: 3,692,089 (GRCm39) V23A probably damaging Het
Atxn1l A T 8: 110,460,230 (GRCm39) C11S probably damaging Het
Bbs9 T G 9: 22,590,244 (GRCm39) S661A probably benign Het
Btrc T C 19: 45,496,198 (GRCm39) V211A probably damaging Het
Camk1g T C 1: 193,030,794 (GRCm39) probably null Het
Capn11 A T 17: 45,943,801 (GRCm39) L578I probably benign Het
Cd82 A T 2: 93,252,239 (GRCm39) I124N probably damaging Het
Cdkl4 G T 17: 80,858,258 (GRCm39) H120Q probably benign Het
Cftr T C 6: 18,319,728 (GRCm39) V1393A probably damaging Het
Col14a1 A T 15: 55,318,706 (GRCm39) R1402* probably null Het
Col6a3 T G 1: 90,727,747 (GRCm39) Y1960S probably benign Het
Col9a1 A T 1: 24,224,127 (GRCm39) Y103F unknown Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Cyp17a1 A T 19: 46,658,166 (GRCm39) C249S probably benign Het
Derl1 A T 15: 57,755,568 (GRCm39) W42R probably benign Het
Dhx36 C A 3: 62,386,747 (GRCm39) M668I probably benign Het
Dnah6 T C 6: 73,044,428 (GRCm39) K3228E possibly damaging Het
Dst C T 1: 34,267,750 (GRCm39) A3050V probably benign Het
Efr3b A G 12: 4,049,594 (GRCm39) Y70H probably damaging Het
Epb42 T A 2: 120,856,324 (GRCm39) T407S possibly damaging Het
Fads2b T A 2: 85,324,387 (GRCm39) probably benign Het
Fap T A 2: 62,342,777 (GRCm39) I608L probably benign Het
Fblim1 A G 4: 141,310,387 (GRCm39) Y292H probably benign Het
Fmod A G 1: 133,968,043 (GRCm39) I28V probably benign Het
Gad2 T A 2: 22,524,985 (GRCm39) Y256* probably null Het
Gapdh G A 6: 125,139,017 (GRCm39) A353V probably benign Het
Gm5460 T G 14: 33,739,149 (GRCm39) W44G unknown Het
Ino80e A T 7: 126,460,974 (GRCm39) V91D probably benign Het
Iqgap2 G A 13: 95,802,258 (GRCm39) P896S probably damaging Het
Kif26b T A 1: 178,692,430 (GRCm39) I457N probably damaging Het
Klc2 T A 19: 5,168,477 (GRCm39) probably benign Het
Ldlrap1 C A 4: 134,495,147 (GRCm39) W22L probably benign Het
Matn3 A G 12: 9,017,665 (GRCm39) D439G possibly damaging Het
Met T C 6: 17,540,510 (GRCm39) L812P probably benign Het
Mki67 A T 7: 135,315,504 (GRCm39) I90N probably damaging Het
Mptx2 A C 1: 173,105,256 (GRCm39) S12A probably benign Het
Mrgpra9 G T 7: 46,885,624 (GRCm39) N14K probably benign Het
Nbeal2 G A 9: 110,456,949 (GRCm39) R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 (GRCm39) I913T probably benign Het
Nuggc G T 14: 65,882,535 (GRCm39) C760F probably benign Het
Or1j13 T A 2: 36,369,629 (GRCm39) N171I probably benign Het
Or2y1f T A 11: 49,184,965 (GRCm39) F272L probably damaging Het
Or4c110 C A 2: 88,832,351 (GRCm39) E94* probably null Het
Or51b6 A G 7: 103,555,913 (GRCm39) N86S Het
Pdgfrb C T 18: 61,214,073 (GRCm39) P953S probably damaging Het
Pemt T G 11: 59,874,285 (GRCm39) I102L probably benign Het
Pla2g4c G T 7: 13,069,154 (GRCm39) M109I probably benign Het
Pla2g4d T A 2: 120,100,466 (GRCm39) Y622F probably damaging Het
Pmpca T A 2: 26,283,531 (GRCm39) V400D probably damaging Het
Pnpt1 G C 11: 29,104,815 (GRCm39) probably null Het
Pramel29 A C 4: 143,935,192 (GRCm39) L183R probably damaging Het
Prrc1 T A 18: 57,496,408 (GRCm39) S120T possibly damaging Het
Prrx2 T G 2: 30,768,578 (GRCm39) V135G probably damaging Het
Qrfprl A G 6: 65,433,260 (GRCm39) K360R probably benign Het
Recql4 T C 15: 76,593,054 (GRCm39) N352S probably benign Het
Sftpa1 T C 14: 40,856,044 (GRCm39) S130P probably damaging Het
Slc35e2 T C 4: 155,695,042 (GRCm39) L136P probably benign Het
Tarbp2 T A 15: 102,430,202 (GRCm39) S155T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmem116 A T 5: 121,620,433 (GRCm39) Y146F Het
Ttc17 C T 2: 94,206,374 (GRCm39) probably null Het
Vmn2r114 G A 17: 23,529,142 (GRCm39) T320I probably benign Het
Vmn2r69 A T 7: 85,055,783 (GRCm39) V785D probably damaging Het
Vmn2r89 T A 14: 51,693,722 (GRCm39) N357K probably damaging Het
Zfp811 A T 17: 33,017,197 (GRCm39) L281Q possibly damaging Het
Other mutations in Or10a3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Or10a3m APN 7 108,313,089 (GRCm39) missense probably benign 0.02
IGL01912:Or10a3m APN 7 108,313,465 (GRCm39) missense possibly damaging 0.60
IGL02182:Or10a3m APN 7 108,313,075 (GRCm39) missense probably benign 0.02
IGL02409:Or10a3m APN 7 108,313,366 (GRCm39) missense probably benign 0.00
IGL02554:Or10a3m APN 7 108,312,949 (GRCm39) missense possibly damaging 0.94
IGL03210:Or10a3m APN 7 108,312,775 (GRCm39) missense probably damaging 1.00
IGL03373:Or10a3m APN 7 108,313,339 (GRCm39) missense probably damaging 1.00
IGL03400:Or10a3m APN 7 108,312,733 (GRCm39) missense probably benign 0.28
R0092:Or10a3m UTSW 7 108,313,031 (GRCm39) missense probably benign
R0741:Or10a3m UTSW 7 108,312,811 (GRCm39) missense probably benign 0.00
R1515:Or10a3m UTSW 7 108,313,148 (GRCm39) missense possibly damaging 0.94
R1982:Or10a3m UTSW 7 108,312,902 (GRCm39) missense probably damaging 1.00
R2176:Or10a3m UTSW 7 108,313,339 (GRCm39) missense probably damaging 1.00
R3967:Or10a3m UTSW 7 108,313,060 (GRCm39) missense probably benign
R4009:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R4010:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R4011:Or10a3m UTSW 7 108,313,366 (GRCm39) missense probably benign 0.00
R5095:Or10a3m UTSW 7 108,313,019 (GRCm39) missense probably damaging 1.00
R5271:Or10a3m UTSW 7 108,313,424 (GRCm39) missense probably damaging 1.00
R5864:Or10a3m UTSW 7 108,312,671 (GRCm39) missense probably benign
R5926:Or10a3m UTSW 7 108,312,794 (GRCm39) missense probably damaging 1.00
R6295:Or10a3m UTSW 7 108,312,845 (GRCm39) missense probably damaging 0.98
R6528:Or10a3m UTSW 7 108,312,638 (GRCm39) missense probably damaging 1.00
R6624:Or10a3m UTSW 7 108,312,743 (GRCm39) missense possibly damaging 0.50
R8029:Or10a3m UTSW 7 108,313,037 (GRCm39) missense possibly damaging 0.70
R8443:Or10a3m UTSW 7 108,313,418 (GRCm39) missense possibly damaging 0.79
R9415:Or10a3m UTSW 7 108,313,042 (GRCm39) missense probably damaging 1.00
R9622:Or10a3m UTSW 7 108,312,677 (GRCm39) missense probably benign 0.30
X0023:Or10a3m UTSW 7 108,313,217 (GRCm39) missense possibly damaging 0.79
Z1088:Or10a3m UTSW 7 108,312,745 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTCTGCACATCCCCATGTAC -3'
(R):5'- CAGTTCTAGCACAGGAGGAGTC -3'

Sequencing Primer
(F):5'- ACATCCCCATGTACCTATTTCTGCAG -3'
(R):5'- TCTAGCACAGGAGGAGTCTCACAG -3'
Posted On 2021-03-08