Incidental Mutation 'R8737:Efr3b'
ID663103
Institutional Source Beutler Lab
Gene Symbol Efr3b
Ensembl Gene ENSMUSG00000020658
Gene NameEFR3 homolog B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8737 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location3962554-4038915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3999594 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 70 (Y70H)
Ref Sequence ENSEMBL: ENSMUSP00000106809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111178]
Predicted Effect probably damaging
Transcript: ENSMUST00000111178
AA Change: Y70H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106809
Gene: ENSMUSG00000020658
AA Change: Y70H

DomainStartEndE-ValueType
SCOP:d1qbkb_ 55 306 1e-3 SMART
low complexity region 591 602 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,269,729 D375V probably damaging Het
Agfg1 C G 1: 82,893,522 P492A probably benign Het
Asb13 T C 13: 3,642,089 V23A probably damaging Het
Atxn1l A T 8: 109,733,598 C11S probably damaging Het
Bbs9 T G 9: 22,678,948 S661A probably benign Het
Btrc T C 19: 45,507,759 V211A probably damaging Het
C130060K24Rik A G 6: 65,456,276 K360R probably benign Het
C87977 A C 4: 144,208,622 L183R probably damaging Het
Camk1g T C 1: 193,348,486 probably null Het
Capn11 A T 17: 45,632,875 L578I probably benign Het
Cd82 A T 2: 93,421,894 I124N probably damaging Het
Cdkl4 G T 17: 80,550,829 H120Q probably benign Het
Cftr T C 6: 18,319,729 V1393A probably damaging Het
Col14a1 A T 15: 55,455,310 R1402* probably null Het
Col6a3 T G 1: 90,800,025 Y1960S probably benign Het
Col9a1 A T 1: 24,185,046 Y103F unknown Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cyp17a1 A T 19: 46,669,727 C249S probably benign Het
Derl1 A T 15: 57,892,172 W42R probably benign Het
Dhx36 C A 3: 62,479,326 M668I probably benign Het
Dnah6 T C 6: 73,067,445 K3228E possibly damaging Het
Dst C T 1: 34,228,669 A3050V probably benign Het
Epb42 T A 2: 121,025,843 T407S possibly damaging Het
Fap T A 2: 62,512,433 I608L probably benign Het
Fblim1 A G 4: 141,583,076 Y292H probably benign Het
Fmod A G 1: 134,040,305 I28V probably benign Het
Gad2 T A 2: 22,634,973 Y256* probably null Het
Gapdh G A 6: 125,162,054 A353V probably benign Het
Gm5460 T G 14: 34,017,192 W44G unknown Het
Ino80e A T 7: 126,861,802 V91D probably benign Het
Iqgap2 G A 13: 95,665,750 P896S probably damaging Het
Kif26b T A 1: 178,864,865 I457N probably damaging Het
Klc2 T A 19: 5,118,449 probably benign Het
Ldlrap1 C A 4: 134,767,836 W22L probably benign Het
Matn3 A G 12: 8,967,665 D439G possibly damaging Het
Met T C 6: 17,540,511 L812P probably benign Het
Mki67 A T 7: 135,713,775 I90N probably damaging Het
Mptx2 A C 1: 173,277,689 S12A probably benign Het
Mrgpra9 G T 7: 47,235,876 N14K probably benign Het
Nbeal2 G A 9: 110,627,881 R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 I913T probably benign Het
Nuggc G T 14: 65,645,086 C760F probably benign Het
Olfr1215 C A 2: 89,002,007 E94* probably null Het
Olfr1392 T A 11: 49,294,138 F272L probably damaging Het
Olfr341 T A 2: 36,479,617 N171I probably benign Het
Olfr512 T A 7: 108,713,757 F135I probably damaging Het
Olfr65 A G 7: 103,906,706 N86S Het
Pdgfrb C T 18: 61,081,001 P953S probably damaging Het
Pemt T G 11: 59,983,459 I102L probably benign Het
Pla2g4c G T 7: 13,335,229 M109I probably benign Het
Pla2g4d T A 2: 120,269,985 Y622F probably damaging Het
Pmpca T A 2: 26,393,519 V400D probably damaging Het
Pnpt1 G C 11: 29,154,815 probably null Het
Prrc1 T A 18: 57,363,336 S120T possibly damaging Het
Prrx2 T G 2: 30,878,566 V135G probably damaging Het
Recql4 T C 15: 76,708,854 N352S probably benign Het
Sftpa1 T C 14: 41,134,087 S130P probably damaging Het
Slc35e2 T C 4: 155,610,585 L136P probably benign Het
Tarbp2 T A 15: 102,521,767 S155T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmem116 A T 5: 121,482,370 Y146F Het
Ttc17 C T 2: 94,376,029 probably null Het
Vmn2r114 G A 17: 23,310,168 T320I probably benign Het
Vmn2r69 A T 7: 85,406,575 V785D probably damaging Het
Vmn2r89 T A 14: 51,456,265 N357K probably damaging Het
Zfp811 A T 17: 32,798,223 L281Q possibly damaging Het
Other mutations in Efr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Efr3b APN 12 3975411 nonsense probably null
IGL01288:Efr3b APN 12 3982865 missense probably damaging 1.00
IGL01467:Efr3b APN 12 3969597 missense probably damaging 0.98
IGL01964:Efr3b APN 12 3982928 missense probably damaging 1.00
IGL02253:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02329:Efr3b APN 12 3992923 splice site probably null
IGL02365:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02373:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02390:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02392:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02494:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02496:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02501:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02529:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02530:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02532:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02699:Efr3b APN 12 3983391 missense probably benign 0.40
IGL02716:Efr3b APN 12 3984627 missense probably damaging 1.00
IGL02904:Efr3b APN 12 3984583 missense probably damaging 0.99
IGL02986:Efr3b APN 12 3966495 missense probably benign 0.13
IGL03171:Efr3b APN 12 3968622 missense probably benign 0.00
IGL03346:Efr3b APN 12 3984648 missense probably damaging 1.00
PIT4418001:Efr3b UTSW 12 3980490 missense possibly damaging 0.64
R0017:Efr3b UTSW 12 3993003 missense probably damaging 0.98
R0189:Efr3b UTSW 12 3982925 missense probably damaging 1.00
R0361:Efr3b UTSW 12 3977923 missense probably benign 0.00
R0469:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0510:Efr3b UTSW 12 3982058 missense probably benign 0.02
R0782:Efr3b UTSW 12 3984686 splice site probably benign
R2042:Efr3b UTSW 12 3984627 missense probably damaging 1.00
R2359:Efr3b UTSW 12 3980136 unclassified probably benign
R3691:Efr3b UTSW 12 3982059 missense possibly damaging 0.84
R3849:Efr3b UTSW 12 3983414 missense probably benign 0.40
R5384:Efr3b UTSW 12 3983419 missense probably benign 0.04
R5819:Efr3b UTSW 12 3992965 missense probably benign 0.21
R5970:Efr3b UTSW 12 3968590 missense possibly damaging 0.93
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6031:Efr3b UTSW 12 3967106 missense possibly damaging 0.90
R6759:Efr3b UTSW 12 3984613 missense probably damaging 1.00
R6969:Efr3b UTSW 12 3968624 missense probably benign 0.08
R7392:Efr3b UTSW 12 3969588 missense probably benign
R7717:Efr3b UTSW 12 3984574 missense probably damaging 1.00
R8071:Efr3b UTSW 12 3982898 missense probably benign 0.02
R8686:Efr3b UTSW 12 4000886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGGCAACTCCTATGGGG -3'
(R):5'- CTTCCCATTAGAGCAGAGCC -3'

Sequencing Primer
(F):5'- AACTCCTATGGGGCCAGCATG -3'
(R):5'- CAGAGCCATGGTGATTTTGAGC -3'
Posted On2021-03-08