Incidental Mutation 'R8737:Iqgap2'
ID663106
Institutional Source Beutler Lab
Gene Symbol Iqgap2
Ensembl Gene ENSMUSG00000021676
Gene NameIQ motif containing GTPase activating protein 2
Synonyms4933417J23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8737 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location95627177-95891922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95665750 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 896 (P896S)
Ref Sequence ENSEMBL: ENSMUSP00000067685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068603]
Predicted Effect probably damaging
Transcript: ENSMUST00000068603
AA Change: P896S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676
AA Change: P896S

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display reduced survival with increased incidence of hepatocellular carcinomas, increased hepatocyte apoptosis, and hepatocyte mitochondrial abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,269,729 D375V probably damaging Het
Agfg1 C G 1: 82,893,522 P492A probably benign Het
Asb13 T C 13: 3,642,089 V23A probably damaging Het
Atxn1l A T 8: 109,733,598 C11S probably damaging Het
Bbs9 T G 9: 22,678,948 S661A probably benign Het
Btrc T C 19: 45,507,759 V211A probably damaging Het
C130060K24Rik A G 6: 65,456,276 K360R probably benign Het
C87977 A C 4: 144,208,622 L183R probably damaging Het
Camk1g T C 1: 193,348,486 probably null Het
Capn11 A T 17: 45,632,875 L578I probably benign Het
Cd82 A T 2: 93,421,894 I124N probably damaging Het
Cdkl4 G T 17: 80,550,829 H120Q probably benign Het
Cftr T C 6: 18,319,729 V1393A probably damaging Het
Col14a1 A T 15: 55,455,310 R1402* probably null Het
Col6a3 T G 1: 90,800,025 Y1960S probably benign Het
Col9a1 A T 1: 24,185,046 Y103F unknown Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cyp17a1 A T 19: 46,669,727 C249S probably benign Het
Derl1 A T 15: 57,892,172 W42R probably benign Het
Dhx36 C A 3: 62,479,326 M668I probably benign Het
Dnah6 T C 6: 73,067,445 K3228E possibly damaging Het
Dst C T 1: 34,228,669 A3050V probably benign Het
Efr3b A G 12: 3,999,594 Y70H probably damaging Het
Epb42 T A 2: 121,025,843 T407S possibly damaging Het
Fap T A 2: 62,512,433 I608L probably benign Het
Fblim1 A G 4: 141,583,076 Y292H probably benign Het
Fmod A G 1: 134,040,305 I28V probably benign Het
Gad2 T A 2: 22,634,973 Y256* probably null Het
Gapdh G A 6: 125,162,054 A353V probably benign Het
Gm5460 T G 14: 34,017,192 W44G unknown Het
Ino80e A T 7: 126,861,802 V91D probably benign Het
Kif26b T A 1: 178,864,865 I457N probably damaging Het
Klc2 T A 19: 5,118,449 probably benign Het
Ldlrap1 C A 4: 134,767,836 W22L probably benign Het
Matn3 A G 12: 8,967,665 D439G possibly damaging Het
Met T C 6: 17,540,511 L812P probably benign Het
Mki67 A T 7: 135,713,775 I90N probably damaging Het
Mptx2 A C 1: 173,277,689 S12A probably benign Het
Mrgpra9 G T 7: 47,235,876 N14K probably benign Het
Nbeal2 G A 9: 110,627,881 R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 I913T probably benign Het
Nuggc G T 14: 65,645,086 C760F probably benign Het
Olfr1215 C A 2: 89,002,007 E94* probably null Het
Olfr1392 T A 11: 49,294,138 F272L probably damaging Het
Olfr341 T A 2: 36,479,617 N171I probably benign Het
Olfr512 T A 7: 108,713,757 F135I probably damaging Het
Olfr65 A G 7: 103,906,706 N86S Het
Pdgfrb C T 18: 61,081,001 P953S probably damaging Het
Pemt T G 11: 59,983,459 I102L probably benign Het
Pla2g4c G T 7: 13,335,229 M109I probably benign Het
Pla2g4d T A 2: 120,269,985 Y622F probably damaging Het
Pmpca T A 2: 26,393,519 V400D probably damaging Het
Pnpt1 G C 11: 29,154,815 probably null Het
Prrc1 T A 18: 57,363,336 S120T possibly damaging Het
Prrx2 T G 2: 30,878,566 V135G probably damaging Het
Recql4 T C 15: 76,708,854 N352S probably benign Het
Sftpa1 T C 14: 41,134,087 S130P probably damaging Het
Slc35e2 T C 4: 155,610,585 L136P probably benign Het
Tarbp2 T A 15: 102,521,767 S155T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmem116 A T 5: 121,482,370 Y146F Het
Ttc17 C T 2: 94,376,029 probably null Het
Vmn2r114 G A 17: 23,310,168 T320I probably benign Het
Vmn2r69 A T 7: 85,406,575 V785D probably damaging Het
Vmn2r89 T A 14: 51,456,265 N357K probably damaging Het
Zfp811 A T 17: 32,798,223 L281Q possibly damaging Het
Other mutations in Iqgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Iqgap2 APN 13 95657944 splice site probably benign
IGL01968:Iqgap2 APN 13 95635582 missense possibly damaging 0.80
IGL02049:Iqgap2 APN 13 95675405 splice site probably benign
IGL02195:Iqgap2 APN 13 95661734 splice site probably benign
IGL02387:Iqgap2 APN 13 95689701 missense probably benign 0.00
IGL02634:Iqgap2 APN 13 95628114 missense probably damaging 1.00
IGL02666:Iqgap2 APN 13 95628056 missense probably damaging 1.00
IGL02685:Iqgap2 APN 13 95671404 missense probably damaging 1.00
IGL02927:Iqgap2 APN 13 95724676 missense possibly damaging 0.62
IGL02943:Iqgap2 APN 13 95661735 splice site probably benign
IGL03167:Iqgap2 APN 13 95684898 missense probably benign 0.34
IGL03169:Iqgap2 APN 13 95731277 splice site probably null
IGL03293:Iqgap2 APN 13 95731434 missense probably damaging 1.00
R0257:Iqgap2 UTSW 13 95724544 critical splice donor site probably null
R0335:Iqgap2 UTSW 13 95635633 missense probably damaging 0.99
R0360:Iqgap2 UTSW 13 95731275 splice site probably benign
R0364:Iqgap2 UTSW 13 95731275 splice site probably benign
R0419:Iqgap2 UTSW 13 95689699 critical splice donor site probably null
R1229:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1290:Iqgap2 UTSW 13 95668513 missense probably damaging 1.00
R1397:Iqgap2 UTSW 13 95632165 missense probably benign 0.32
R1498:Iqgap2 UTSW 13 95646805 missense probably benign
R1513:Iqgap2 UTSW 13 95630010 missense probably damaging 1.00
R1630:Iqgap2 UTSW 13 95689785 missense probably benign
R2088:Iqgap2 UTSW 13 95891663 critical splice donor site probably null
R2928:Iqgap2 UTSW 13 95682236 missense probably benign
R3026:Iqgap2 UTSW 13 95673056 critical splice acceptor site probably null
R3720:Iqgap2 UTSW 13 95668528 splice site probably null
R3846:Iqgap2 UTSW 13 95673678 splice site probably benign
R4056:Iqgap2 UTSW 13 95750033 missense probably damaging 1.00
R4077:Iqgap2 UTSW 13 95657867 missense probably damaging 1.00
R4353:Iqgap2 UTSW 13 95671396 missense probably damaging 1.00
R4517:Iqgap2 UTSW 13 95664061 critical splice donor site probably null
R4628:Iqgap2 UTSW 13 95763329 missense probably benign 0.17
R4686:Iqgap2 UTSW 13 95721609 missense probably damaging 0.98
R4724:Iqgap2 UTSW 13 95635497 missense possibly damaging 0.73
R4826:Iqgap2 UTSW 13 95763275 missense probably damaging 1.00
R4847:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R4967:Iqgap2 UTSW 13 95630006 missense probably benign 0.00
R4973:Iqgap2 UTSW 13 95657797 splice site probably null
R5010:Iqgap2 UTSW 13 95673743 missense probably benign 0.19
R5086:Iqgap2 UTSW 13 95635580 missense probably benign 0.01
R5496:Iqgap2 UTSW 13 95630053 missense probably damaging 1.00
R5512:Iqgap2 UTSW 13 95675376 nonsense probably null
R5629:Iqgap2 UTSW 13 95632174 missense probably damaging 1.00
R5824:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5830:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5831:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5832:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5833:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5834:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5852:Iqgap2 UTSW 13 95675372 missense probably damaging 0.99
R5888:Iqgap2 UTSW 13 95635610 missense possibly damaging 0.89
R5889:Iqgap2 UTSW 13 95632042 missense probably benign 0.00
R6093:Iqgap2 UTSW 13 95628963 missense probably damaging 0.99
R6141:Iqgap2 UTSW 13 95721686 splice site probably null
R6404:Iqgap2 UTSW 13 95729477 missense probably benign 0.28
R6434:Iqgap2 UTSW 13 95682933 missense possibly damaging 0.85
R6648:Iqgap2 UTSW 13 95682211 missense probably benign 0.27
R6658:Iqgap2 UTSW 13 95660332 missense probably damaging 1.00
R6903:Iqgap2 UTSW 13 95661057 missense probably damaging 1.00
R7223:Iqgap2 UTSW 13 95628972 missense probably damaging 1.00
R7327:Iqgap2 UTSW 13 95635655 missense probably benign 0.00
R7371:Iqgap2 UTSW 13 95700338 splice site probably null
R7378:Iqgap2 UTSW 13 95732890 critical splice donor site probably null
R7441:Iqgap2 UTSW 13 95628076 missense probably benign 0.23
R7575:Iqgap2 UTSW 13 95661623 missense probably damaging 0.99
R7671:Iqgap2 UTSW 13 95628119 missense probably damaging 0.98
R7713:Iqgap2 UTSW 13 95731444 missense probably benign 0.01
R7806:Iqgap2 UTSW 13 95682257 missense probably benign 0.00
R7893:Iqgap2 UTSW 13 95689709 missense probably damaging 0.96
R8052:Iqgap2 UTSW 13 95657879 missense probably damaging 0.96
R8121:Iqgap2 UTSW 13 95724568 missense probably benign 0.00
R8261:Iqgap2 UTSW 13 95635570 missense probably damaging 1.00
R8301:Iqgap2 UTSW 13 95682151 critical splice donor site probably null
R8369:Iqgap2 UTSW 13 95661603 missense probably damaging 1.00
R8485:Iqgap2 UTSW 13 95660151 missense probably damaging 0.99
R8709:Iqgap2 UTSW 13 95660205 missense probably damaging 0.99
R8710:Iqgap2 UTSW 13 95660248 missense probably benign 0.24
X0066:Iqgap2 UTSW 13 95671383 missense probably damaging 0.98
Z1176:Iqgap2 UTSW 13 95731443 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATCATGAGCACCTGCCTTGG -3'
(R):5'- CCATGTAATAAGCAGCACTAACATG -3'

Sequencing Primer
(F):5'- GCTTTCTCGTGGGCTTTATAC -3'
(R):5'- CAATGTAGCTTCCTAAACTGTCATTG -3'
Posted On2021-03-08