Incidental Mutation 'R8737:Cyp17a1'
ID663123
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Namecytochrome P450, family 17, subfamily a, polypeptide 1
Synonymssteroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R8737 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46667165-46672974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46669727 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 249 (C249S)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: C249S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: C249S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T A 2: 85,494,043 probably benign Het
Aff3 T A 1: 38,269,729 D375V probably damaging Het
Agfg1 C G 1: 82,893,522 P492A probably benign Het
Asb13 T C 13: 3,642,089 V23A probably damaging Het
Atxn1l A T 8: 109,733,598 C11S probably damaging Het
Bbs9 T G 9: 22,678,948 S661A probably benign Het
Btrc T C 19: 45,507,759 V211A probably damaging Het
C130060K24Rik A G 6: 65,456,276 K360R probably benign Het
C87977 A C 4: 144,208,622 L183R probably damaging Het
Camk1g T C 1: 193,348,486 probably null Het
Capn11 A T 17: 45,632,875 L578I probably benign Het
Cd82 A T 2: 93,421,894 I124N probably damaging Het
Cdkl4 G T 17: 80,550,829 H120Q probably benign Het
Cftr T C 6: 18,319,729 V1393A probably damaging Het
Col14a1 A T 15: 55,455,310 R1402* probably null Het
Col6a3 T G 1: 90,800,025 Y1960S probably benign Het
Col9a1 A T 1: 24,185,046 Y103F unknown Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Derl1 A T 15: 57,892,172 W42R probably benign Het
Dhx36 C A 3: 62,479,326 M668I probably benign Het
Dnah6 T C 6: 73,067,445 K3228E possibly damaging Het
Dst C T 1: 34,228,669 A3050V probably benign Het
Efr3b A G 12: 3,999,594 Y70H probably damaging Het
Epb42 T A 2: 121,025,843 T407S possibly damaging Het
Fap T A 2: 62,512,433 I608L probably benign Het
Fblim1 A G 4: 141,583,076 Y292H probably benign Het
Fmod A G 1: 134,040,305 I28V probably benign Het
Gad2 T A 2: 22,634,973 Y256* probably null Het
Gapdh G A 6: 125,162,054 A353V probably benign Het
Gm5460 T G 14: 34,017,192 W44G unknown Het
Ino80e A T 7: 126,861,802 V91D probably benign Het
Iqgap2 G A 13: 95,665,750 P896S probably damaging Het
Kif26b T A 1: 178,864,865 I457N probably damaging Het
Klc2 T A 19: 5,118,449 probably benign Het
Ldlrap1 C A 4: 134,767,836 W22L probably benign Het
Matn3 A G 12: 8,967,665 D439G possibly damaging Het
Met T C 6: 17,540,511 L812P probably benign Het
Mki67 A T 7: 135,713,775 I90N probably damaging Het
Mptx2 A C 1: 173,277,689 S12A probably benign Het
Mrgpra9 G T 7: 47,235,876 N14K probably benign Het
Nbeal2 G A 9: 110,627,881 R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 I913T probably benign Het
Nuggc G T 14: 65,645,086 C760F probably benign Het
Olfr1215 C A 2: 89,002,007 E94* probably null Het
Olfr1392 T A 11: 49,294,138 F272L probably damaging Het
Olfr341 T A 2: 36,479,617 N171I probably benign Het
Olfr512 T A 7: 108,713,757 F135I probably damaging Het
Olfr65 A G 7: 103,906,706 N86S Het
Pdgfrb C T 18: 61,081,001 P953S probably damaging Het
Pemt T G 11: 59,983,459 I102L probably benign Het
Pla2g4c G T 7: 13,335,229 M109I probably benign Het
Pla2g4d T A 2: 120,269,985 Y622F probably damaging Het
Pmpca T A 2: 26,393,519 V400D probably damaging Het
Pnpt1 G C 11: 29,154,815 probably null Het
Prrc1 T A 18: 57,363,336 S120T possibly damaging Het
Prrx2 T G 2: 30,878,566 V135G probably damaging Het
Recql4 T C 15: 76,708,854 N352S probably benign Het
Sftpa1 T C 14: 41,134,087 S130P probably damaging Het
Slc35e2 T C 4: 155,610,585 L136P probably benign Het
Tarbp2 T A 15: 102,521,767 S155T probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tmem116 A T 5: 121,482,370 Y146F Het
Ttc17 C T 2: 94,376,029 probably null Het
Vmn2r114 G A 17: 23,310,168 T320I probably benign Het
Vmn2r69 A T 7: 85,406,575 V785D probably damaging Het
Vmn2r89 T A 14: 51,456,265 N357K probably damaging Het
Zfp811 A T 17: 32,798,223 L281Q possibly damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7025:Cyp17a1 UTSW 19 46670980 missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46671094 critical splice acceptor site probably null
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGCCTCACTTCCAACATC -3'
(R):5'- AGACTGGCGTGGAGACTTTC -3'

Sequencing Primer
(F):5'- ATGTCCCTCTAAGAACTGTTTCAG -3'
(R):5'- GCGTGGAGACTTTCTTAAACC -3'
Posted On2021-03-08