Incidental Mutation 'R8737:Cyp17a1'
ID 663123
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Name cytochrome P450, family 17, subfamily a, polypeptide 1
Synonyms p450c17, Cyp17, steroid 17-alpha hydroxylase
MMRRC Submission 068584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R8737 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 46655604-46661439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46658166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 249 (C249S)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
AlphaFold P27786
Predicted Effect probably benign
Transcript: ENSMUST00000026012
AA Change: C249S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: C249S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T A 1: 38,308,810 (GRCm39) D375V probably damaging Het
Agfg1 C G 1: 82,871,243 (GRCm39) P492A probably benign Het
Asb13 T C 13: 3,692,089 (GRCm39) V23A probably damaging Het
Atxn1l A T 8: 110,460,230 (GRCm39) C11S probably damaging Het
Bbs9 T G 9: 22,590,244 (GRCm39) S661A probably benign Het
Btrc T C 19: 45,496,198 (GRCm39) V211A probably damaging Het
Camk1g T C 1: 193,030,794 (GRCm39) probably null Het
Capn11 A T 17: 45,943,801 (GRCm39) L578I probably benign Het
Cd82 A T 2: 93,252,239 (GRCm39) I124N probably damaging Het
Cdkl4 G T 17: 80,858,258 (GRCm39) H120Q probably benign Het
Cftr T C 6: 18,319,728 (GRCm39) V1393A probably damaging Het
Col14a1 A T 15: 55,318,706 (GRCm39) R1402* probably null Het
Col6a3 T G 1: 90,727,747 (GRCm39) Y1960S probably benign Het
Col9a1 A T 1: 24,224,127 (GRCm39) Y103F unknown Het
Cux1 A G 5: 136,311,796 (GRCm39) V1180A probably damaging Het
Derl1 A T 15: 57,755,568 (GRCm39) W42R probably benign Het
Dhx36 C A 3: 62,386,747 (GRCm39) M668I probably benign Het
Dnah6 T C 6: 73,044,428 (GRCm39) K3228E possibly damaging Het
Dst C T 1: 34,267,750 (GRCm39) A3050V probably benign Het
Efr3b A G 12: 4,049,594 (GRCm39) Y70H probably damaging Het
Epb42 T A 2: 120,856,324 (GRCm39) T407S possibly damaging Het
Fads2b T A 2: 85,324,387 (GRCm39) probably benign Het
Fap T A 2: 62,342,777 (GRCm39) I608L probably benign Het
Fblim1 A G 4: 141,310,387 (GRCm39) Y292H probably benign Het
Fmod A G 1: 133,968,043 (GRCm39) I28V probably benign Het
Gad2 T A 2: 22,524,985 (GRCm39) Y256* probably null Het
Gapdh G A 6: 125,139,017 (GRCm39) A353V probably benign Het
Gm5460 T G 14: 33,739,149 (GRCm39) W44G unknown Het
Ino80e A T 7: 126,460,974 (GRCm39) V91D probably benign Het
Iqgap2 G A 13: 95,802,258 (GRCm39) P896S probably damaging Het
Kif26b T A 1: 178,692,430 (GRCm39) I457N probably damaging Het
Klc2 T A 19: 5,168,477 (GRCm39) probably benign Het
Ldlrap1 C A 4: 134,495,147 (GRCm39) W22L probably benign Het
Matn3 A G 12: 9,017,665 (GRCm39) D439G possibly damaging Het
Met T C 6: 17,540,510 (GRCm39) L812P probably benign Het
Mki67 A T 7: 135,315,504 (GRCm39) I90N probably damaging Het
Mptx2 A C 1: 173,105,256 (GRCm39) S12A probably benign Het
Mrgpra9 G T 7: 46,885,624 (GRCm39) N14K probably benign Het
Nbeal2 G A 9: 110,456,949 (GRCm39) R2350C probably damaging Het
Nsmaf A G 4: 6,396,748 (GRCm39) I913T probably benign Het
Nuggc G T 14: 65,882,535 (GRCm39) C760F probably benign Het
Or10a3m T A 7: 108,312,964 (GRCm39) F135I probably damaging Het
Or1j13 T A 2: 36,369,629 (GRCm39) N171I probably benign Het
Or2y1f T A 11: 49,184,965 (GRCm39) F272L probably damaging Het
Or4c110 C A 2: 88,832,351 (GRCm39) E94* probably null Het
Or51b6 A G 7: 103,555,913 (GRCm39) N86S Het
Pdgfrb C T 18: 61,214,073 (GRCm39) P953S probably damaging Het
Pemt T G 11: 59,874,285 (GRCm39) I102L probably benign Het
Pla2g4c G T 7: 13,069,154 (GRCm39) M109I probably benign Het
Pla2g4d T A 2: 120,100,466 (GRCm39) Y622F probably damaging Het
Pmpca T A 2: 26,283,531 (GRCm39) V400D probably damaging Het
Pnpt1 G C 11: 29,104,815 (GRCm39) probably null Het
Pramel29 A C 4: 143,935,192 (GRCm39) L183R probably damaging Het
Prrc1 T A 18: 57,496,408 (GRCm39) S120T possibly damaging Het
Prrx2 T G 2: 30,768,578 (GRCm39) V135G probably damaging Het
Qrfprl A G 6: 65,433,260 (GRCm39) K360R probably benign Het
Recql4 T C 15: 76,593,054 (GRCm39) N352S probably benign Het
Sftpa1 T C 14: 40,856,044 (GRCm39) S130P probably damaging Het
Slc35e2 T C 4: 155,695,042 (GRCm39) L136P probably benign Het
Tarbp2 T A 15: 102,430,202 (GRCm39) S155T probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tmem116 A T 5: 121,620,433 (GRCm39) Y146F Het
Ttc17 C T 2: 94,206,374 (GRCm39) probably null Het
Vmn2r114 G A 17: 23,529,142 (GRCm39) T320I probably benign Het
Vmn2r69 A T 7: 85,055,783 (GRCm39) V785D probably damaging Het
Vmn2r89 T A 14: 51,693,722 (GRCm39) N357K probably damaging Het
Zfp811 A T 17: 33,017,197 (GRCm39) L281Q possibly damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46,659,495 (GRCm39) missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46,659,110 (GRCm39) missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46,659,531 (GRCm39) missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46,661,046 (GRCm39) nonsense probably null
IGL02349:Cyp17a1 APN 19 46,655,936 (GRCm39) missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46,661,005 (GRCm39) missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46,657,790 (GRCm39) missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46,661,050 (GRCm39) missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46,655,796 (GRCm39) missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46,659,474 (GRCm39) missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46,658,162 (GRCm39) missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46,656,462 (GRCm39) missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46,658,990 (GRCm39) missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46,661,093 (GRCm39) missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46,661,095 (GRCm39) missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46,657,761 (GRCm39) missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46,661,159 (GRCm39) missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46,657,673 (GRCm39) missense probably benign
R6729:Cyp17a1 UTSW 19 46,659,020 (GRCm39) missense probably benign
R7025:Cyp17a1 UTSW 19 46,659,419 (GRCm39) missense probably damaging 0.98
R7395:Cyp17a1 UTSW 19 46,659,134 (GRCm39) missense probably benign
R8056:Cyp17a1 UTSW 19 46,659,030 (GRCm39) missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46,656,516 (GRCm39) missense probably benign 0.09
R8735:Cyp17a1 UTSW 19 46,659,533 (GRCm39) critical splice acceptor site probably null
R9091:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9270:Cyp17a1 UTSW 19 46,656,030 (GRCm39) missense probably benign 0.00
R9364:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
R9554:Cyp17a1 UTSW 19 46,657,165 (GRCm39) missense probably damaging 1.00
X0020:Cyp17a1 UTSW 19 46,659,459 (GRCm39) missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46,661,098 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGCCTCACTTCCAACATC -3'
(R):5'- AGACTGGCGTGGAGACTTTC -3'

Sequencing Primer
(F):5'- ATGTCCCTCTAAGAACTGTTTCAG -3'
(R):5'- GCGTGGAGACTTTCTTAAACC -3'
Posted On 2021-03-08