Mutagenetix > Incidental Mutation

Incidental Mutation 'R8738:Stat4'

663126

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.311) question?

Stock #

R8738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 52076552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 217 (T217M)

Ref Sequence

ENSEMBL: ENSMUSP00000027277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027277
AA Change: T217M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: T217M

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168302
AA Change: T217M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: T217M

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	G	A	9: 15,284,918	T283M	probably damaging	Het
Abca9	A	G	11: 110,165,991	M1T	probably null	Het
Ackr1	T	C	1: 173,332,385	Y189C	probably damaging	Het
Acsm4	A	G	7: 119,705,041	D303G	probably benign	Het
Arfgef2	A	T	2: 166,866,947	M1060L	probably benign	Het
Arhgef40	T	A	14: 52,000,957	F1298I	probably damaging	Het
Atg2a	T	C	19: 6,256,644	I1453T	probably benign	Het
B4galnt1	A	T	10: 127,171,715	D495V	probably benign	Het
Brpf3	T	A	17: 28,821,240	D878E	probably benign	Het
C3	A	G	17: 57,204,015	*1664R	probably null	Het
Cap2	A	G	13: 46,531,072	T73A	probably benign	Het
Ccr6	A	T	17: 8,256,562	I200F	probably damaging	Het
Cdc42bpb	C	T	12: 111,307,787	G1021R	probably benign	Het
Cidea	C	A	18: 67,366,415	S124*	probably null	Het
Cnst	C	A	1: 179,592,709	T135K	probably benign	Het
Crebbp	A	T	16: 4,119,088	M805K	probably benign	Het
Crybb1	A	G	5: 112,263,573	Y119C	probably damaging	Het
Cux1	G	T	5: 136,373,366	T121K	probably damaging	Het
Dnah11	A	T	12: 118,085,649		probably null	Het
Dnmbp	T	C	19: 43,912,238	T48A	probably damaging	Het
Dysf	G	A	6: 84,194,371	G1787E	probably damaging	Het
Gcm2	T	A	13: 41,104,620	R177S	probably benign	Het
Gdf6	G	T	4: 9,859,429	R170S	probably damaging	Het
Gm16686	A	T	4: 88,755,538	M18K	unknown	Het
Gm36864	C	T	7: 44,236,880	Q179*	probably null	Het
Golgb1	A	G	16: 36,916,313	D2015G	probably damaging	Het
Gtf2i	A	G	5: 134,295,520	L30P	probably damaging	Het
Herc2	A	G	7: 56,148,654	E1955G	possibly damaging	Het
Hes3	A	T	4: 152,287,675	D37E	probably damaging	Het
Igha	A	G	12: 113,259,524	V161A	probably damaging	Het
Isl2	T	G	9: 55,545,438	S327A	probably benign	Het
Itk	A	G	11: 46,340,712	L339P	probably damaging	Het
Kcnb2	T	C	1: 15,710,424	S507P	probably benign	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lhfpl4	C	A	6: 113,194,073	V51L	possibly damaging	Het
Lhpp	A	G	7: 132,641,532	Y159C	probably damaging	Het
Lrwd1	C	A	5: 136,133,403	E159*	probably null	Het
Map3k13	A	G	16: 21,926,258	T856A	probably damaging	Het
Mcm8	A	G	2: 132,823,221	T206A	probably benign	Het
Megf6	A	G	4: 154,267,979	K1265R	probably benign	Het
Mrgprb2	A	G	7: 48,552,900	Y26H	probably benign	Het
Mug1	T	C	6: 121,840,249		probably benign	Het
Mysm1	C	T	4: 94,967,959	G134S	probably damaging	Het
Nlrp3	A	C	11: 59,549,390	I598L	probably benign	Het
Npas2	A	T	1: 39,292,716	I71F	possibly damaging	Het
Nr1h5	A	G	3: 102,954,699	S85P	probably benign	Het
Nrcam	T	A	12: 44,572,292	V868D	possibly damaging	Het
Oas1a	A	G	5: 120,901,956	F191L	probably damaging	Het
Olfr761	A	T	17: 37,952,782	Y81N	possibly damaging	Het
Orc3	A	T	4: 34,599,778	L125H	possibly damaging	Het
Osbpl7	A	G	11: 97,056,077	E402G	possibly damaging	Het
Otof	G	A	5: 30,388,624	Q462*	probably null	Het
Phlda2	A	C	7: 143,502,222	I90S	probably damaging	Het
Plin3	C	T	17: 56,286,490	V75I	probably benign	Het
Pms1	A	T	1: 53,282,036	S13T	possibly damaging	Het
Ppm1d	A	G	11: 85,345,906	K504E	probably damaging	Het
Rflna	A	T	5: 125,010,477	I93F	probably damaging	Het
Rnpc3	T	A	3: 113,621,156	M193L	probably benign	Het
Sema3e	A	T	5: 14,164,155	I145F	possibly damaging	Het
Serpinb1b	C	A	13: 33,087,517	N90K	probably damaging	Het
Sfswap	A	G	5: 129,543,281	D538G	possibly damaging	Het
Snx14	A	T	9: 88,407,400	D266E	possibly damaging	Het
Taf13	T	C	3: 108,578,128	M40T	probably damaging	Het
Tenm4	A	G	7: 96,873,840	T1530A	probably damaging	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnfrsf14	T	C	4: 154,923,253	I220M	possibly damaging	Het
Tnk2	T	C	16: 32,665,900	W60R	probably damaging	Het
Tph2	A	T	10: 115,179,709		probably benign	Het
Unc13b	A	T	4: 43,177,564	K2797N	unknown	Het
Upf1	G	A	8: 70,333,322	P996S	probably benign	Het
Upf1	C	G	8: 70,333,323	M995I	probably benign	Het
Vcan	C	T	13: 89,692,320	V1702M	probably benign	Het
Vmn2r57	T	C	7: 41,427,596	D382G	probably benign	Het
Xxylt1	C	T	16: 31,081,146	A64T	probably benign	Het
Zcchc8	A	G	5: 123,703,007	S407P	probably damaging	Het
Zdhhc19	T	A	16: 32,498,369	F109Y	probably damaging	Het
Zfp638	T	C	6: 83,954,763		probably null	Het
Zfp691	A	G	4: 119,170,664	S124P	probably damaging	Het
Zfp804a	T	A	2: 82,259,106	V1093D	probably damaging	Het
Zfp986	A	C	4: 145,898,980	Q70P	probably benign	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0329:Stat4	UTSW	1	52090870	intron	probably benign
R0973:Stat4	UTSW	1	52096820	missense	probably damaging	0.99
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1529:Stat4	UTSW	1	52011793	missense	probably damaging	1.00
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3789:Stat4	UTSW	1	52011796	missense	probably benign	0.07
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R4373:Stat4	UTSW	1	52071941	critical splice donor site	probably null
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
R9729:Stat4	UTSW	1	52102603	missense	possibly damaging	0.94
R9767:Stat4	UTSW	1	52102494	missense	probably damaging	1.00
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CCGTGGTCACAGTTCTCATG -3'
(R):5'- TGCACTCTCACTGAGCAAC -3'

Sequencing Primer
(F):5'- GTCACAGTTCTCATGCTATTATTCAG -3'
(R):5'- TGAGCAACTGCAGCCCTTG -3'

Posted On

2021-03-08