Incidental Mutation 'R8738:Ackr1'
ID663128
Institutional Source Beutler Lab
Gene Symbol Ackr1
Ensembl Gene ENSMUSG00000037872
Gene Nameatypical chemokine receptor 1 (Duffy blood group)
SynonymsDarc, ESTM35, Dfy, FY, CCBP1, CD234
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8738 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173331886-173333750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173332385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 189 (Y189C)
Ref Sequence ENSEMBL: ENSMUSP00000045134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000038227] [ENSMUST00000111220] [ENSMUST00000194046]
Predicted Effect probably benign
Transcript: ENSMUST00000005470
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038227
AA Change: Y189C

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045134
Gene: ENSMUSG00000037872
AA Change: Y189C

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 317 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111220
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194046
SMART Domains Protein: ENSMUSP00000141765
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are healthy, but erythrocytes lack CXC and CC chemokine-binding activity, such that when challenged with LPS result in increased inflammatory infiltrates in lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Ackr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ackr1 APN 1 173332829 missense probably benign 0.23
R0479:Ackr1 UTSW 1 173332145 missense probably benign 0.02
R1664:Ackr1 UTSW 1 173332866 missense probably benign 0.36
R1713:Ackr1 UTSW 1 173332349 missense probably benign 0.38
R2273:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2274:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2275:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R4469:Ackr1 UTSW 1 173332545 splice site probably null
R5871:Ackr1 UTSW 1 173332073 missense probably damaging 0.99
R6523:Ackr1 UTSW 1 173332553 critical splice donor site probably null
R7062:Ackr1 UTSW 1 173332115 missense possibly damaging 0.68
R7751:Ackr1 UTSW 1 173332212 missense probably damaging 0.96
R8234:Ackr1 UTSW 1 173332015 missense probably benign 0.12
R8477:Ackr1 UTSW 1 173332188 missense probably damaging 1.00
R8697:Ackr1 UTSW 1 173332208 missense probably damaging 0.96
R8851:Ackr1 UTSW 1 173332116 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TATGAGAACCATCCCATGAGGCC -3'
(R):5'- TATGCAACCTGGGCTACTGG -3'

Sequencing Primer
(F):5'- TCCCATGAGGCCACCAG -3'
(R):5'- CAACCTGGGCTACTGGGTATG -3'
Posted On2021-03-08