Incidental Mutation 'R8738:Oas1a'
ID 663149
Institutional Source Beutler Lab
Gene Symbol Oas1a
Ensembl Gene ENSMUSG00000052776
Gene Name 2'-5' oligoadenylate synthetase 1A
Synonyms L3
MMRRC Submission 068585-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121034319-121045584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121040019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 191 (F191L)
Ref Sequence ENSEMBL: ENSMUSP00000079198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080322]
AlphaFold P11928
Predicted Effect probably damaging
Transcript: ENSMUST00000080322
AA Change: F191L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079198
Gene: ENSMUSG00000052776
AA Change: F191L

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 9.8e-14 PFAM
Pfam:OAS1_C 164 349 1.9e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,196,214 (GRCm39) T283M probably damaging Het
Abca9 A G 11: 110,056,817 (GRCm39) M1T probably null Het
Ackr1 T C 1: 173,159,952 (GRCm39) Y189C probably damaging Het
Acsm4 A G 7: 119,304,264 (GRCm39) D303G probably benign Het
Arfgef2 A T 2: 166,708,867 (GRCm39) M1060L probably benign Het
Arhgef40 T A 14: 52,238,414 (GRCm39) F1298I probably damaging Het
Atg2a T C 19: 6,306,674 (GRCm39) I1453T probably benign Het
B4galnt1 A T 10: 127,007,584 (GRCm39) D495V probably benign Het
Brpf3 T A 17: 29,040,214 (GRCm39) D878E probably benign Het
C3 A G 17: 57,511,015 (GRCm39) *1664R probably null Het
Cap2 A G 13: 46,684,548 (GRCm39) T73A probably benign Het
Ccr6 A T 17: 8,475,394 (GRCm39) I200F probably damaging Het
Cdc42bpb C T 12: 111,274,221 (GRCm39) G1021R probably benign Het
Cidea C A 18: 67,499,485 (GRCm39) S124* probably null Het
Cnst C A 1: 179,420,274 (GRCm39) T135K probably benign Het
Crebbp A T 16: 3,936,952 (GRCm39) M805K probably benign Het
Crybb1 A G 5: 112,411,439 (GRCm39) Y119C probably damaging Het
Cux1 G T 5: 136,402,220 (GRCm39) T121K probably damaging Het
Dnah11 A T 12: 118,049,384 (GRCm39) probably null Het
Dnmbp T C 19: 43,900,677 (GRCm39) T48A probably damaging Het
Dysf G A 6: 84,171,353 (GRCm39) G1787E probably damaging Het
Gcm2 T A 13: 41,258,096 (GRCm39) R177S probably benign Het
Gdf6 G T 4: 9,859,429 (GRCm39) R170S probably damaging Het
Gm16686 A T 4: 88,673,775 (GRCm39) M18K unknown Het
Gm36864 C T 7: 43,886,304 (GRCm39) Q179* probably null Het
Golgb1 A G 16: 36,736,675 (GRCm39) D2015G probably damaging Het
Gtf2i A G 5: 134,324,374 (GRCm39) L30P probably damaging Het
Herc2 A G 7: 55,798,402 (GRCm39) E1955G possibly damaging Het
Hes3 A T 4: 152,372,132 (GRCm39) D37E probably damaging Het
Igha A G 12: 113,223,144 (GRCm39) V161A probably damaging Het
Isl2 T G 9: 55,452,722 (GRCm39) S327A probably benign Het
Itk A G 11: 46,231,539 (GRCm39) L339P probably damaging Het
Kcnb2 T C 1: 15,780,648 (GRCm39) S507P probably benign Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lhfpl4 C A 6: 113,171,034 (GRCm39) V51L possibly damaging Het
Lhpp A G 7: 132,243,261 (GRCm39) Y159C probably damaging Het
Lrwd1 C A 5: 136,162,257 (GRCm39) E159* probably null Het
Map3k13 A G 16: 21,745,008 (GRCm39) T856A probably damaging Het
Mcm8 A G 2: 132,665,141 (GRCm39) T206A probably benign Het
Megf6 A G 4: 154,352,436 (GRCm39) K1265R probably benign Het
Mrgprb2 A G 7: 48,202,648 (GRCm39) Y26H probably benign Het
Mug1 T C 6: 121,817,208 (GRCm39) probably benign Het
Mysm1 C T 4: 94,856,196 (GRCm39) G134S probably damaging Het
Nlrp3 A C 11: 59,440,216 (GRCm39) I598L probably benign Het
Npas2 A T 1: 39,331,797 (GRCm39) I71F possibly damaging Het
Nr1h5 A G 3: 102,862,015 (GRCm39) S85P probably benign Het
Nrcam T A 12: 44,619,075 (GRCm39) V868D possibly damaging Het
Or14j8 A T 17: 38,263,673 (GRCm39) Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 (GRCm39) L125H possibly damaging Het
Osbpl7 A G 11: 96,946,903 (GRCm39) E402G possibly damaging Het
Otof G A 5: 30,545,968 (GRCm39) Q462* probably null Het
Phlda2 A C 7: 143,055,959 (GRCm39) I90S probably damaging Het
Plin3 C T 17: 56,593,490 (GRCm39) V75I probably benign Het
Pms1 A T 1: 53,321,195 (GRCm39) S13T possibly damaging Het
Ppm1d A G 11: 85,236,732 (GRCm39) K504E probably damaging Het
Rflna A T 5: 125,087,541 (GRCm39) I93F probably damaging Het
Rnpc3 T A 3: 113,414,805 (GRCm39) M193L probably benign Het
Sema3e A T 5: 14,214,169 (GRCm39) I145F possibly damaging Het
Serpinb1b C A 13: 33,271,500 (GRCm39) N90K probably damaging Het
Sfswap A G 5: 129,620,345 (GRCm39) D538G possibly damaging Het
Snx14 A T 9: 88,289,453 (GRCm39) D266E possibly damaging Het
Stat4 C T 1: 52,115,711 (GRCm39) T217M possibly damaging Het
Taf13 T C 3: 108,485,444 (GRCm39) M40T probably damaging Het
Tenm4 A G 7: 96,523,047 (GRCm39) T1530A probably damaging Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tnfrsf14 T C 4: 155,007,710 (GRCm39) I220M possibly damaging Het
Tnk2 T C 16: 32,484,718 (GRCm39) W60R probably damaging Het
Tph2 A T 10: 115,015,614 (GRCm39) probably benign Het
Unc13b A T 4: 43,177,564 (GRCm39) K2797N unknown Het
Upf1 C G 8: 70,785,973 (GRCm39) M995I probably benign Het
Upf1 G A 8: 70,785,972 (GRCm39) P996S probably benign Het
Vcan C T 13: 89,840,439 (GRCm39) V1702M probably benign Het
Vmn2r57 T C 7: 41,077,020 (GRCm39) D382G probably benign Het
Xxylt1 C T 16: 30,899,964 (GRCm39) A64T probably benign Het
Zcchc8 A G 5: 123,841,070 (GRCm39) S407P probably damaging Het
Zdhhc19 T A 16: 32,317,187 (GRCm39) F109Y probably damaging Het
Zfp638 T C 6: 83,931,745 (GRCm39) probably null Het
Zfp691 A G 4: 119,027,861 (GRCm39) S124P probably damaging Het
Zfp804a T A 2: 82,089,450 (GRCm39) V1093D probably damaging Het
Zfp986 A C 4: 145,625,550 (GRCm39) Q70P probably benign Het
Other mutations in Oas1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01822:Oas1a APN 5 121,037,277 (GRCm39) missense probably benign 0.01
IGL02299:Oas1a APN 5 121,043,755 (GRCm39) missense probably benign
IGL02951:Oas1a APN 5 121,043,727 (GRCm39) missense probably damaging 1.00
IGL03112:Oas1a APN 5 121,036,412 (GRCm39) missense possibly damaging 0.95
IGL03230:Oas1a APN 5 121,036,419 (GRCm39) missense probably benign 0.23
IGL03356:Oas1a APN 5 121,043,908 (GRCm39) missense probably damaging 0.99
IGL03379:Oas1a APN 5 121,035,062 (GRCm39) missense possibly damaging 0.70
R0625:Oas1a UTSW 5 121,037,322 (GRCm39) missense probably damaging 1.00
R1279:Oas1a UTSW 5 121,035,241 (GRCm39) critical splice donor site probably null
R1914:Oas1a UTSW 5 121,043,876 (GRCm39) missense possibly damaging 0.48
R1915:Oas1a UTSW 5 121,043,876 (GRCm39) missense possibly damaging 0.48
R4758:Oas1a UTSW 5 121,045,401 (GRCm39) missense probably damaging 1.00
R4928:Oas1a UTSW 5 121,043,787 (GRCm39) missense probably benign
R5267:Oas1a UTSW 5 121,037,284 (GRCm39) missense probably benign 0.00
R5442:Oas1a UTSW 5 121,035,269 (GRCm39) missense probably benign 0.00
R5487:Oas1a UTSW 5 121,045,490 (GRCm39) missense probably damaging 1.00
R6853:Oas1a UTSW 5 121,045,491 (GRCm39) missense possibly damaging 0.95
R6880:Oas1a UTSW 5 121,040,003 (GRCm39) missense probably damaging 0.97
R7953:Oas1a UTSW 5 121,035,080 (GRCm39) missense probably benign 0.32
R8043:Oas1a UTSW 5 121,035,080 (GRCm39) missense probably benign 0.32
R8363:Oas1a UTSW 5 121,043,902 (GRCm39) missense probably damaging 1.00
R8863:Oas1a UTSW 5 121,043,943 (GRCm39) missense probably damaging 1.00
R9474:Oas1a UTSW 5 121,037,317 (GRCm39) missense probably damaging 1.00
R9475:Oas1a UTSW 5 121,037,317 (GRCm39) missense probably damaging 1.00
R9612:Oas1a UTSW 5 121,040,028 (GRCm39) missense possibly damaging 0.70
Z1177:Oas1a UTSW 5 121,039,958 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTGACCACATGATAAAGCTATGACC -3'
(R):5'- GTTCACTGAACACCATAGGCAGTG -3'

Sequencing Primer
(F):5'- ACATGATAAAGCTATGACCTCAAAAG -3'
(R):5'- CCATAGGCAGTGATTCTAGACCTG -3'
Posted On 2021-03-08