Incidental Mutation 'R8738:Zcchc8'
ID 663150
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Name zinc finger, CCHC domain containing 8
Synonyms 5730565F05Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027494; MGI: 1917900

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 123698294-123721100 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123703007 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 407 (S407P)
Ref Sequence ENSEMBL: ENSMUSP00000031376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282]
AlphaFold Q9CYA6
Predicted Effect probably damaging
Transcript: ENSMUST00000031376
AA Change: S407P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: S407P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196282
AA Change: S407P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: S407P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mug1 T C 6: 121,840,249 probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Tph2 A T 10: 115,179,709 probably benign Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123704569 missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123720719 critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123700918 missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123719483 splice site probably benign
3-1:Zcchc8 UTSW 5 123709481 missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123700932 missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123707337 missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123717027 missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123700658 missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123700373 nonsense probably null
R2216:Zcchc8 UTSW 5 123707403 missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123700597 missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123700703 missense probably benign 0.05
R2964:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R2966:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123700909 missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
R8791:Zcchc8 UTSW 5 123707299 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAGCTATAGAATCTCACCACTACG -3'
(R):5'- CAAGAGTTTGCCGCTGAGTC -3'

Sequencing Primer
(F):5'- TACGAATGTTTGCCAGCTACAC -3'
(R):5'- AACCCTTGAAGTCACTGTGTAGC -3'
Posted On 2021-03-08