Incidental Mutation 'R8738:Cux1'
ID663155
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R8738 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136373366 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 121 (T121K)
Ref Sequence ENSEMBL: ENSMUSP00000135086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004097
AA Change: T132K

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: T132K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175918
AA Change: T95K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705
AA Change: T95K

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175975
AA Change: T132K

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: T132K

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: T121K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: T121K

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176216
AA Change: T132K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: T132K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176486
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176745
AA Change: T132K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: T132K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: T217K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: T217K

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177297
AA Change: T132K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: T132K

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 splice site probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 splice site probably null
R7699:Cux1 UTSW 5 136485739 critical splice donor site probably null
R7861:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136363307 missense probably benign 0.00
R7916:Cux1 UTSW 5 136282961 missense probably damaging 1.00
R8023:Cux1 UTSW 5 136373397 missense probably damaging 0.99
R8154:Cux1 UTSW 5 136252580 missense probably damaging 1.00
R8267:Cux1 UTSW 5 136282999 missense probably damaging 1.00
R8289:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8305:Cux1 UTSW 5 136360009 missense probably benign 0.02
R8319:Cux1 UTSW 5 136565397 missense probably benign 0.02
R8405:Cux1 UTSW 5 136275387 missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136275090 missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136308504 missense probably damaging 0.99
R8671:Cux1 UTSW 5 136250600 missense probably damaging 1.00
R8680:Cux1 UTSW 5 136307856 missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R8793:Cux1 UTSW 5 136565685 missense unknown
R8897:Cux1 UTSW 5 136286769 missense probably damaging 1.00
R8954:Cux1 UTSW 5 136373349 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGATTCGGCTGCTTGC -3'
(R):5'- AGGCCCTAAGAGAATCTCCAG -3'

Sequencing Primer
(F):5'- CCCCACCCTGGCTTCATGAG -3'
(R):5'- AGGGCTTGCCTAGAATTCAC -3'
Posted On2021-03-08