Mutagenetix > Incidental Mutation

Incidental Mutation 'R8738:Upf1'

663170

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R8738 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 70333323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 995 (M995I)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000140239] [ENSMUST00000165819] [ENSMUST00000207684] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably benign
Transcript: ENSMUST00000075666
AA Change: M995I

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: M995I

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140239

SMART Domains

Protein: ENSMUSP00000120598
Gene: ENSMUSG00000087408

Domain	Start	End	E-Value	Type
low complexity region	49	68	N/A	INTRINSIC
TLC	97	311	1.24e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165819

SMART Domains

Protein: ENSMUSP00000128325
Gene: ENSMUSG00000087408

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:TGFb_propeptide	33	169	7e-16	PFAM
low complexity region	225	237	N/A	INTRINSIC
TGFB	251	357	6.22e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207684

Predicted Effect

probably benign
Transcript: ENSMUST00000215817
AA Change: M984I

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	G	A	9: 15,284,918	T283M	probably damaging	Het
Abca9	A	G	11: 110,165,991	M1T	probably null	Het
Ackr1	T	C	1: 173,332,385	Y189C	probably damaging	Het
Acsm4	A	G	7: 119,705,041	D303G	probably benign	Het
Arfgef2	A	T	2: 166,866,947	M1060L	probably benign	Het
Arhgef40	T	A	14: 52,000,957	F1298I	probably damaging	Het
Atg2a	T	C	19: 6,256,644	I1453T	probably benign	Het
B4galnt1	A	T	10: 127,171,715	D495V	probably benign	Het
Brpf3	T	A	17: 28,821,240	D878E	probably benign	Het
C3	A	G	17: 57,204,015	*1664R	probably null	Het
Cap2	A	G	13: 46,531,072	T73A	probably benign	Het
Ccr6	A	T	17: 8,256,562	I200F	probably damaging	Het
Cdc42bpb	C	T	12: 111,307,787	G1021R	probably benign	Het
Cidea	C	A	18: 67,366,415	S124*	probably null	Het
Cnst	C	A	1: 179,592,709	T135K	probably benign	Het
Crebbp	A	T	16: 4,119,088	M805K	probably benign	Het
Crybb1	A	G	5: 112,263,573	Y119C	probably damaging	Het
Cux1	G	T	5: 136,373,366	T121K	probably damaging	Het
Dnah11	A	T	12: 118,085,649		probably null	Het
Dnmbp	T	C	19: 43,912,238	T48A	probably damaging	Het
Dysf	G	A	6: 84,194,371	G1787E	probably damaging	Het
Gcm2	T	A	13: 41,104,620	R177S	probably benign	Het
Gdf6	G	T	4: 9,859,429	R170S	probably damaging	Het
Gm16686	A	T	4: 88,755,538	M18K	unknown	Het
Gm36864	C	T	7: 44,236,880	Q179*	probably null	Het
Golgb1	A	G	16: 36,916,313	D2015G	probably damaging	Het
Gtf2i	A	G	5: 134,295,520	L30P	probably damaging	Het
Herc2	A	G	7: 56,148,654	E1955G	possibly damaging	Het
Hes3	A	T	4: 152,287,675	D37E	probably damaging	Het
Igha	A	G	12: 113,259,524	V161A	probably damaging	Het
Isl2	T	G	9: 55,545,438	S327A	probably benign	Het
Itk	A	G	11: 46,340,712	L339P	probably damaging	Het
Kcnb2	T	C	1: 15,710,424	S507P	probably benign	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lhfpl4	C	A	6: 113,194,073	V51L	possibly damaging	Het
Lhpp	A	G	7: 132,641,532	Y159C	probably damaging	Het
Lrwd1	C	A	5: 136,133,403	E159*	probably null	Het
Map3k13	A	G	16: 21,926,258	T856A	probably damaging	Het
Mcm8	A	G	2: 132,823,221	T206A	probably benign	Het
Megf6	A	G	4: 154,267,979	K1265R	probably benign	Het
Mrgprb2	A	G	7: 48,552,900	Y26H	probably benign	Het
Mug1	T	C	6: 121,840,249		probably benign	Het
Mysm1	C	T	4: 94,967,959	G134S	probably damaging	Het
Nlrp3	A	C	11: 59,549,390	I598L	probably benign	Het
Npas2	A	T	1: 39,292,716	I71F	possibly damaging	Het
Nr1h5	A	G	3: 102,954,699	S85P	probably benign	Het
Nrcam	T	A	12: 44,572,292	V868D	possibly damaging	Het
Oas1a	A	G	5: 120,901,956	F191L	probably damaging	Het
Olfr761	A	T	17: 37,952,782	Y81N	possibly damaging	Het
Orc3	A	T	4: 34,599,778	L125H	possibly damaging	Het
Osbpl7	A	G	11: 97,056,077	E402G	possibly damaging	Het
Otof	G	A	5: 30,388,624	Q462*	probably null	Het
Phlda2	A	C	7: 143,502,222	I90S	probably damaging	Het
Plin3	C	T	17: 56,286,490	V75I	probably benign	Het
Pms1	A	T	1: 53,282,036	S13T	possibly damaging	Het
Ppm1d	A	G	11: 85,345,906	K504E	probably damaging	Het
Rflna	A	T	5: 125,010,477	I93F	probably damaging	Het
Rnpc3	T	A	3: 113,621,156	M193L	probably benign	Het
Sema3e	A	T	5: 14,164,155	I145F	possibly damaging	Het
Serpinb1b	C	A	13: 33,087,517	N90K	probably damaging	Het
Sfswap	A	G	5: 129,543,281	D538G	possibly damaging	Het
Snx14	A	T	9: 88,407,400	D266E	possibly damaging	Het
Stat4	C	T	1: 52,076,552	T217M	possibly damaging	Het
Taf13	T	C	3: 108,578,128	M40T	probably damaging	Het
Tenm4	A	G	7: 96,873,840	T1530A	probably damaging	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnfrsf14	T	C	4: 154,923,253	I220M	possibly damaging	Het
Tnk2	T	C	16: 32,665,900	W60R	probably damaging	Het
Tph2	A	T	10: 115,179,709		probably benign	Het
Unc13b	A	T	4: 43,177,564	K2797N	unknown	Het
Vcan	C	T	13: 89,692,320	V1702M	probably benign	Het
Vmn2r57	T	C	7: 41,427,596	D382G	probably benign	Het
Xxylt1	C	T	16: 31,081,146	A64T	probably benign	Het
Zcchc8	A	G	5: 123,703,007	S407P	probably damaging	Het
Zdhhc19	T	A	16: 32,498,369	F109Y	probably damaging	Het
Zfp638	T	C	6: 83,954,763		probably null	Het
Zfp691	A	G	4: 119,170,664	S124P	probably damaging	Het
Zfp804a	T	A	2: 82,259,106	V1093D	probably damaging	Het
Zfp986	A	C	4: 145,898,980	Q70P	probably benign	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACACGTAACCCTGTGTGAG -3'
(R):5'- CTAGTTCATGGCAGCCAGTG -3'

Sequencing Primer
(F):5'- CAAAGCGGTTCTTCTGGCG -3'
(R):5'- TCATGGCAGCCAGTGTCCAC -3'

Posted On

2021-03-08