Mutagenetix > Incidental Mutation

Incidental Mutation 'R8738:Nlrp3'

663176

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R8738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 59549390 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 598 (I598L)

Ref Sequence

ENSEMBL: ENSMUSP00000078440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

probably benign
Transcript: ENSMUST00000079476
AA Change: I598L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: I598L

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000101148
AA Change: I598L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: I598L

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Meta Mutation Damage Score

0.0723

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (76/78)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	G	A	9: 15,284,918	T283M	probably damaging	Het
Abca9	A	G	11: 110,165,991	M1T	probably null	Het
Ackr1	T	C	1: 173,332,385	Y189C	probably damaging	Het
Acsm4	A	G	7: 119,705,041	D303G	probably benign	Het
Arfgef2	A	T	2: 166,866,947	M1060L	probably benign	Het
Arhgef40	T	A	14: 52,000,957	F1298I	probably damaging	Het
Atg2a	T	C	19: 6,256,644	I1453T	probably benign	Het
B4galnt1	A	T	10: 127,171,715	D495V	probably benign	Het
Brpf3	T	A	17: 28,821,240	D878E	probably benign	Het
C3	A	G	17: 57,204,015	*1664R	probably null	Het
Cap2	A	G	13: 46,531,072	T73A	probably benign	Het
Ccr6	A	T	17: 8,256,562	I200F	probably damaging	Het
Cdc42bpb	C	T	12: 111,307,787	G1021R	probably benign	Het
Cidea	C	A	18: 67,366,415	S124*	probably null	Het
Cnst	C	A	1: 179,592,709	T135K	probably benign	Het
Crebbp	A	T	16: 4,119,088	M805K	probably benign	Het
Crybb1	A	G	5: 112,263,573	Y119C	probably damaging	Het
Cux1	G	T	5: 136,373,366	T121K	probably damaging	Het
Dnah11	A	T	12: 118,085,649		probably null	Het
Dnmbp	T	C	19: 43,912,238	T48A	probably damaging	Het
Dysf	G	A	6: 84,194,371	G1787E	probably damaging	Het
Gcm2	T	A	13: 41,104,620	R177S	probably benign	Het
Gdf6	G	T	4: 9,859,429	R170S	probably damaging	Het
Gm16686	A	T	4: 88,755,538	M18K	unknown	Het
Gm36864	C	T	7: 44,236,880	Q179*	probably null	Het
Golgb1	A	G	16: 36,916,313	D2015G	probably damaging	Het
Gtf2i	A	G	5: 134,295,520	L30P	probably damaging	Het
Herc2	A	G	7: 56,148,654	E1955G	possibly damaging	Het
Hes3	A	T	4: 152,287,675	D37E	probably damaging	Het
Igha	A	G	12: 113,259,524	V161A	probably damaging	Het
Isl2	T	G	9: 55,545,438	S327A	probably benign	Het
Itk	A	G	11: 46,340,712	L339P	probably damaging	Het
Kcnb2	T	C	1: 15,710,424	S507P	probably benign	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lhfpl4	C	A	6: 113,194,073	V51L	possibly damaging	Het
Lhpp	A	G	7: 132,641,532	Y159C	probably damaging	Het
Lrwd1	C	A	5: 136,133,403	E159*	probably null	Het
Map3k13	A	G	16: 21,926,258	T856A	probably damaging	Het
Mcm8	A	G	2: 132,823,221	T206A	probably benign	Het
Megf6	A	G	4: 154,267,979	K1265R	probably benign	Het
Mrgprb2	A	G	7: 48,552,900	Y26H	probably benign	Het
Mug1	T	C	6: 121,840,249		probably benign	Het
Mysm1	C	T	4: 94,967,959	G134S	probably damaging	Het
Npas2	A	T	1: 39,292,716	I71F	possibly damaging	Het
Nr1h5	A	G	3: 102,954,699	S85P	probably benign	Het
Nrcam	T	A	12: 44,572,292	V868D	possibly damaging	Het
Oas1a	A	G	5: 120,901,956	F191L	probably damaging	Het
Olfr761	A	T	17: 37,952,782	Y81N	possibly damaging	Het
Orc3	A	T	4: 34,599,778	L125H	possibly damaging	Het
Osbpl7	A	G	11: 97,056,077	E402G	possibly damaging	Het
Otof	G	A	5: 30,388,624	Q462*	probably null	Het
Phlda2	A	C	7: 143,502,222	I90S	probably damaging	Het
Plin3	C	T	17: 56,286,490	V75I	probably benign	Het
Pms1	A	T	1: 53,282,036	S13T	possibly damaging	Het
Ppm1d	A	G	11: 85,345,906	K504E	probably damaging	Het
Rflna	A	T	5: 125,010,477	I93F	probably damaging	Het
Rnpc3	T	A	3: 113,621,156	M193L	probably benign	Het
Sema3e	A	T	5: 14,164,155	I145F	possibly damaging	Het
Serpinb1b	C	A	13: 33,087,517	N90K	probably damaging	Het
Sfswap	A	G	5: 129,543,281	D538G	possibly damaging	Het
Snx14	A	T	9: 88,407,400	D266E	possibly damaging	Het
Stat4	C	T	1: 52,076,552	T217M	possibly damaging	Het
Taf13	T	C	3: 108,578,128	M40T	probably damaging	Het
Tenm4	A	G	7: 96,873,840	T1530A	probably damaging	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnfrsf14	T	C	4: 154,923,253	I220M	possibly damaging	Het
Tnk2	T	C	16: 32,665,900	W60R	probably damaging	Het
Tph2	A	T	10: 115,179,709		probably benign	Het
Unc13b	A	T	4: 43,177,564	K2797N	unknown	Het
Upf1	G	A	8: 70,333,322	P996S	probably benign	Het
Upf1	C	G	8: 70,333,323	M995I	probably benign	Het
Vcan	C	T	13: 89,692,320	V1702M	probably benign	Het
Vmn2r57	T	C	7: 41,427,596	D382G	probably benign	Het
Xxylt1	C	T	16: 31,081,146	A64T	probably benign	Het
Zcchc8	A	G	5: 123,703,007	S407P	probably damaging	Het
Zdhhc19	T	A	16: 32,498,369	F109Y	probably damaging	Het
Zfp638	T	C	6: 83,954,763		probably null	Het
Zfp691	A	G	4: 119,170,664	S124P	probably damaging	Het
Zfp804a	T	A	2: 82,259,106	V1093D	probably damaging	Het
Zfp986	A	C	4: 145,898,980	Q70P	probably benign	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- ACTATTTGCTGGAAGAGGAGGC -3'
(R):5'- ACGTGGTCCATTCTGGTAGAG -3'

Sequencing Primer
(F):5'- CTGGAAGAGGAGGCAGAGG -3'
(R):5'- CCATTCTGGTAGAGAGGTTGATCTC -3'

Posted On

2021-03-08