Mutagenetix > Incidental Mutations

Incidental Mutation 'R8738:Ppm1d'

663177

Institutional Source

Beutler Lab

Gene Symbol

Ppm1d

Ensembl Gene

ENSMUSG00000020525

Gene Name

protein phosphatase 1D magnesium-dependent, delta isoform

Synonyms

Wip1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85311244-85347066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85345906 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 504 (K504E)

Ref Sequence

ENSEMBL: ENSMUSP00000020835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020835]

AlphaFold

Q9QZ67

Predicted Effect

probably damaging
Transcript: ENSMUST00000020835
AA Change: K504E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: K504E

Domain	Start	End	E-Value	Type
PP2Cc	1	366	1.4e-76	SMART
PP2C_SIG	78	368	6.09e0	SMART
low complexity region	403	415	N/A	INTRINSIC
Blast:PP2Cc	416	476	1e-19	BLAST

Meta Mutation Damage Score

0.0932

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	G	A	9: 15,284,918	T283M	probably damaging	Het
Abca9	A	G	11: 110,165,991	M1T	probably null	Het
Ackr1	T	C	1: 173,332,385	Y189C	probably damaging	Het
Acsm4	A	G	7: 119,705,041	D303G	probably benign	Het
Arfgef2	A	T	2: 166,866,947	M1060L	probably benign	Het
Arhgef40	T	A	14: 52,000,957	F1298I	probably damaging	Het
Atg2a	T	C	19: 6,256,644	I1453T	probably benign	Het
B4galnt1	A	T	10: 127,171,715	D495V	probably benign	Het
Brpf3	T	A	17: 28,821,240	D878E	probably benign	Het
C3	A	G	17: 57,204,015	*1664R	probably null	Het
Cap2	A	G	13: 46,531,072	T73A	probably benign	Het
Ccr6	A	T	17: 8,256,562	I200F	probably damaging	Het
Cdc42bpb	C	T	12: 111,307,787	G1021R	probably benign	Het
Cidea	C	A	18: 67,366,415	S124*	probably null	Het
Cnst	C	A	1: 179,592,709	T135K	probably benign	Het
Crebbp	A	T	16: 4,119,088	M805K	probably benign	Het
Crybb1	A	G	5: 112,263,573	Y119C	probably damaging	Het
Cux1	G	T	5: 136,373,366	T121K	probably damaging	Het
Dnah11	A	T	12: 118,085,649		probably null	Het
Dnmbp	T	C	19: 43,912,238	T48A	probably damaging	Het
Dysf	G	A	6: 84,194,371	G1787E	probably damaging	Het
Gcm2	T	A	13: 41,104,620	R177S	probably benign	Het
Gdf6	G	T	4: 9,859,429	R170S	probably damaging	Het
Gm16686	A	T	4: 88,755,538	M18K	unknown	Het
Gm36864	C	T	7: 44,236,880	Q179*	probably null	Het
Golgb1	A	G	16: 36,916,313	D2015G	probably damaging	Het
Gtf2i	A	G	5: 134,295,520	L30P	probably damaging	Het
Herc2	A	G	7: 56,148,654	E1955G	possibly damaging	Het
Hes3	A	T	4: 152,287,675	D37E	probably damaging	Het
Igha	A	G	12: 113,259,524	V161A	probably damaging	Het
Isl2	T	G	9: 55,545,438	S327A	probably benign	Het
Itk	A	G	11: 46,340,712	L339P	probably damaging	Het
Kcnb2	T	C	1: 15,710,424	S507P	probably benign	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lhfpl4	C	A	6: 113,194,073	V51L	possibly damaging	Het
Lhpp	A	G	7: 132,641,532	Y159C	probably damaging	Het
Lrwd1	C	A	5: 136,133,403	E159*	probably null	Het
Map3k13	A	G	16: 21,926,258	T856A	probably damaging	Het
Mcm8	A	G	2: 132,823,221	T206A	probably benign	Het
Megf6	A	G	4: 154,267,979	K1265R	probably benign	Het
Mrgprb2	A	G	7: 48,552,900	Y26H	probably benign	Het
Mug1	T	C	6: 121,840,249		probably benign	Het
Mysm1	C	T	4: 94,967,959	G134S	probably damaging	Het
Nlrp3	A	C	11: 59,549,390	I598L	probably benign	Het
Npas2	A	T	1: 39,292,716	I71F	possibly damaging	Het
Nr1h5	A	G	3: 102,954,699	S85P	probably benign	Het
Nrcam	T	A	12: 44,572,292	V868D	possibly damaging	Het
Oas1a	A	G	5: 120,901,956	F191L	probably damaging	Het
Olfr761	A	T	17: 37,952,782	Y81N	possibly damaging	Het
Orc3	A	T	4: 34,599,778	L125H	possibly damaging	Het
Osbpl7	A	G	11: 97,056,077	E402G	possibly damaging	Het
Otof	G	A	5: 30,388,624	Q462*	probably null	Het
Phlda2	A	C	7: 143,502,222	I90S	probably damaging	Het
Plin3	C	T	17: 56,286,490	V75I	probably benign	Het
Pms1	A	T	1: 53,282,036	S13T	possibly damaging	Het
Rflna	A	T	5: 125,010,477	I93F	probably damaging	Het
Rnpc3	T	A	3: 113,621,156	M193L	probably benign	Het
Sema3e	A	T	5: 14,164,155	I145F	possibly damaging	Het
Serpinb1b	C	A	13: 33,087,517	N90K	probably damaging	Het
Sfswap	A	G	5: 129,543,281	D538G	possibly damaging	Het
Snx14	A	T	9: 88,407,400	D266E	possibly damaging	Het
Stat4	C	T	1: 52,076,552	T217M	possibly damaging	Het
Taf13	T	C	3: 108,578,128	M40T	probably damaging	Het
Tenm4	A	G	7: 96,873,840	T1530A	probably damaging	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnfrsf14	T	C	4: 154,923,253	I220M	possibly damaging	Het
Tnk2	T	C	16: 32,665,900	W60R	probably damaging	Het
Tph2	A	T	10: 115,179,709		probably benign	Het
Unc13b	A	T	4: 43,177,564	K2797N	unknown	Het
Upf1	G	A	8: 70,333,322	P996S	probably benign	Het
Upf1	C	G	8: 70,333,323	M995I	probably benign	Het
Vcan	C	T	13: 89,692,320	V1702M	probably benign	Het
Vmn2r57	T	C	7: 41,427,596	D382G	probably benign	Het
Xxylt1	C	T	16: 31,081,146	A64T	probably benign	Het
Zcchc8	A	G	5: 123,703,007	S407P	probably damaging	Het
Zdhhc19	T	A	16: 32,498,369	F109Y	probably damaging	Het
Zfp638	T	C	6: 83,954,763		probably null	Het
Zfp691	A	G	4: 119,170,664	S124P	probably damaging	Het
Zfp804a	T	A	2: 82,259,106	V1093D	probably damaging	Het
Zfp986	A	C	4: 145,898,980	Q70P	probably benign	Het

Other mutations in Ppm1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02095:Ppm1d	APN	11	85327006	missense	probably benign	0.04
IGL02351:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02358:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02496:Ppm1d	APN	11	85339666	missense	possibly damaging	0.51
IGL02667:Ppm1d	APN	11	85332285	missense	probably damaging	1.00
IGL02885:Ppm1d	APN	11	85326944	missense	possibly damaging	0.52
IGL03085:Ppm1d	APN	11	85337163	missense	probably null	0.80
R0114:Ppm1d	UTSW	11	85326905	missense	probably damaging	1.00
R0606:Ppm1d	UTSW	11	85345877	missense	probably benign	0.27
R1014:Ppm1d	UTSW	11	85337154	missense	probably damaging	0.98
R1548:Ppm1d	UTSW	11	85339605	missense	probably damaging	1.00
R3774:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R3775:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R4025:Ppm1d	UTSW	11	85345757	missense	probably benign	0.09
R4065:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4067:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4118:Ppm1d	UTSW	11	85311582	missense	probably benign	0.01
R5169:Ppm1d	UTSW	11	85332370	missense	probably damaging	1.00
R5384:Ppm1d	UTSW	11	85311783	missense	probably damaging	0.98
R5861:Ppm1d	UTSW	11	85311848	missense	possibly damaging	0.70
R5890:Ppm1d	UTSW	11	85326908	missense	probably damaging	1.00
R6394:Ppm1d	UTSW	11	85339672	missense	probably benign
R6992:Ppm1d	UTSW	11	85332352	missense	probably damaging	1.00
R7006:Ppm1d	UTSW	11	85337151	missense	possibly damaging	0.92
R7297:Ppm1d	UTSW	11	85345995	missense	probably damaging	1.00
R7993:Ppm1d	UTSW	11	85326951	missense	probably damaging	1.00
R8099:Ppm1d	UTSW	11	85339666	missense	possibly damaging	0.51
R8697:Ppm1d	UTSW	11	85337160	missense	possibly damaging	0.95
R9018:Ppm1d	UTSW	11	85337135	missense	probably damaging	0.98
R9188:Ppm1d	UTSW	11	85345921	missense	possibly damaging	0.93
Z1176:Ppm1d	UTSW	11	85339573	missense	probably benign	0.09
Z1177:Ppm1d	UTSW	11	85326963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCGCAGTAATGCCTTCTCAGAG -3'
(R):5'- AGTTTGACAGAGTGCCTGCG -3'

Sequencing Primer
(F):5'- CTCAGAGAAGTTTTTAGAGGTCCCAG -3'
(R):5'- CTGGGATGCTGTAGGGAGAC -3'

Posted On

2021-03-08