Incidental Mutation 'R8738:Ppm1d'
ID 663177
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85345906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 504 (K504E)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835]
AlphaFold Q9QZ67
Predicted Effect probably damaging
Transcript: ENSMUST00000020835
AA Change: K504E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: K504E

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mug1 T C 6: 121,840,249 probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Tph2 A T 10: 115,179,709 probably benign Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4065:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCAGTAATGCCTTCTCAGAG -3'
(R):5'- AGTTTGACAGAGTGCCTGCG -3'

Sequencing Primer
(F):5'- CTCAGAGAAGTTTTTAGAGGTCCCAG -3'
(R):5'- CTGGGATGCTGTAGGGAGAC -3'
Posted On 2021-03-08