Incidental Mutation 'R8738:Dnah11'
ID 663183
Institutional Source Beutler Lab
Gene Symbol Dnah11
Ensembl Gene ENSMUSG00000018581
Gene Name dynein, axonemal, heavy chain 11
Synonyms b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo
MMRRC Submission 068585-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 117877982-118199043 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 118085649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084806]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000084806
SMART Domains Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:DHC_N1 218 794 1.6e-162 PFAM
low complexity region 1266 1282 N/A INTRINSIC
Pfam:DHC_N2 1297 1705 1e-130 PFAM
low complexity region 1757 1773 N/A INTRINSIC
AAA 1869 1963 1.51e0 SMART
Pfam:AAA_5 2150 2286 1.6e-12 PFAM
AAA 2474 2619 1.48e-1 SMART
AAA 2819 2931 4.57e-1 SMART
Pfam:MT 3069 3413 3.2e-162 PFAM
Pfam:AAA_9 3434 3656 2.9e-88 PFAM
Pfam:Dynein_heavy 3790 4486 7.1e-235 PFAM
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mug1 T C 6: 121,840,249 probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Tph2 A T 10: 115,179,709 probably benign Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Dnah11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Dnah11 APN 12 118198745 missense probably benign 0.28
IGL00422:Dnah11 APN 12 118068096 missense probably damaging 1.00
IGL00436:Dnah11 APN 12 118036459 missense possibly damaging 0.56
IGL00540:Dnah11 APN 12 118186922 missense probably benign 0.01
IGL00687:Dnah11 APN 12 117922004 splice site probably benign
IGL00833:Dnah11 APN 12 118179580 missense probably damaging 1.00
IGL00906:Dnah11 APN 12 117911202 missense probably damaging 1.00
IGL00952:Dnah11 APN 12 118196651 missense possibly damaging 0.56
IGL01111:Dnah11 APN 12 118142934 splice site probably benign
IGL01121:Dnah11 APN 12 118050695 missense probably benign 0.02
IGL01143:Dnah11 APN 12 118012740 missense probably damaging 1.00
IGL01359:Dnah11 APN 12 117982999 missense probably damaging 0.99
IGL01372:Dnah11 APN 12 118192399 missense probably damaging 1.00
IGL01410:Dnah11 APN 12 118047256 nonsense probably null
IGL01418:Dnah11 APN 12 117987482 nonsense probably null
IGL01444:Dnah11 APN 12 118020232 missense possibly damaging 0.91
IGL01606:Dnah11 APN 12 117983032 missense probably benign 0.15
IGL01645:Dnah11 APN 12 118186998 missense possibly damaging 0.90
IGL01932:Dnah11 APN 12 118192270 splice site probably benign
IGL02104:Dnah11 APN 12 118192390 missense probably benign
IGL02151:Dnah11 APN 12 118059888 splice site probably benign
IGL02189:Dnah11 APN 12 118082579 missense probably benign 0.00
IGL02417:Dnah11 APN 12 118057180 missense probably damaging 1.00
IGL02421:Dnah11 APN 12 118186902 missense probably damaging 1.00
IGL02444:Dnah11 APN 12 117975873 splice site probably benign
IGL02474:Dnah11 APN 12 118027445 splice site probably null
IGL02526:Dnah11 APN 12 118179618 missense possibly damaging 0.70
IGL02887:Dnah11 APN 12 117911040 missense probably damaging 1.00
IGL03011:Dnah11 APN 12 118012377 missense probably benign 0.08
IGL03061:Dnah11 APN 12 117903121 missense probably damaging 1.00
IGL03182:Dnah11 APN 12 118030291 missense probably damaging 0.99
IGL03220:Dnah11 APN 12 118105985 missense probably benign
IGL03238:Dnah11 APN 12 118109898 missense probably damaging 1.00
IGL03493:Dnah11 APN 12 118012798 missense probably benign 0.00
P0045:Dnah11 UTSW 12 118030327 missense probably benign
R0009:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R0066:Dnah11 UTSW 12 118126886 missense probably benign 0.05
R0172:Dnah11 UTSW 12 117987453 missense probably damaging 1.00
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0206:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0208:Dnah11 UTSW 12 118043774 missense probably damaging 0.98
R0230:Dnah11 UTSW 12 117983056 nonsense probably null
R0270:Dnah11 UTSW 12 118041013 missense probably damaging 1.00
R0311:Dnah11 UTSW 12 118127133 missense probably benign 0.03
R0325:Dnah11 UTSW 12 118012339 missense probably benign
R0370:Dnah11 UTSW 12 117995227 missense probably benign
R0416:Dnah11 UTSW 12 117911058 missense probably damaging 1.00
R0505:Dnah11 UTSW 12 118106510 missense probably damaging 1.00
R0540:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0554:Dnah11 UTSW 12 117931178 missense probably benign 0.01
R0607:Dnah11 UTSW 12 118082511 missense probably damaging 1.00
R0620:Dnah11 UTSW 12 117987469 missense probably damaging 1.00
R0635:Dnah11 UTSW 12 118007996 missense probably damaging 1.00
R0755:Dnah11 UTSW 12 117954829 missense possibly damaging 0.95
R0755:Dnah11 UTSW 12 118198625 missense probably benign 0.17
R0789:Dnah11 UTSW 12 117911232 missense probably damaging 1.00
R0833:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0835:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R0836:Dnah11 UTSW 12 118196662 missense probably benign 0.01
R0846:Dnah11 UTSW 12 117933850 missense probably damaging 0.97
R0865:Dnah11 UTSW 12 118190844 nonsense probably null
R0928:Dnah11 UTSW 12 118045562 missense probably damaging 1.00
R0939:Dnah11 UTSW 12 118060407 missense probably damaging 1.00
R1203:Dnah11 UTSW 12 117933812 missense possibly damaging 0.81
R1394:Dnah11 UTSW 12 117972364 missense possibly damaging 0.75
R1398:Dnah11 UTSW 12 118057106 nonsense probably null
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1465:Dnah11 UTSW 12 118038695 missense probably damaging 1.00
R1500:Dnah11 UTSW 12 118012829 splice site probably null
R1535:Dnah11 UTSW 12 118018730 missense probably damaging 1.00
R1539:Dnah11 UTSW 12 117931256 missense probably benign 0.01
R1554:Dnah11 UTSW 12 118082499 missense possibly damaging 0.92
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1574:Dnah11 UTSW 12 118060317 missense probably damaging 1.00
R1615:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R1618:Dnah11 UTSW 12 118015465 missense probably damaging 0.98
R1638:Dnah11 UTSW 12 118015419 missense possibly damaging 0.81
R1659:Dnah11 UTSW 12 118120724 missense possibly damaging 0.94
R1671:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1678:Dnah11 UTSW 12 117933845 missense possibly damaging 0.50
R1699:Dnah11 UTSW 12 118190868 missense probably damaging 1.00
R1712:Dnah11 UTSW 12 118196644 missense probably benign 0.32
R1728:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1729:Dnah11 UTSW 12 117916931 missense probably damaging 1.00
R1764:Dnah11 UTSW 12 118190825 missense probably benign 0.31
R1780:Dnah11 UTSW 12 118027558 missense probably damaging 1.00
R1789:Dnah11 UTSW 12 118038780 missense probably damaging 0.99
R1800:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1863:Dnah11 UTSW 12 118063852 missense possibly damaging 0.92
R1892:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R1907:Dnah11 UTSW 12 118127556 missense possibly damaging 0.66
R1964:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R1967:Dnah11 UTSW 12 117916788 missense probably damaging 1.00
R1997:Dnah11 UTSW 12 118082468 missense possibly damaging 0.64
R2086:Dnah11 UTSW 12 118113871 missense possibly damaging 0.82
R2092:Dnah11 UTSW 12 118012716 missense possibly damaging 0.50
R2108:Dnah11 UTSW 12 118020353 missense probably damaging 1.00
R2140:Dnah11 UTSW 12 118008810 missense probably benign 0.01
R2261:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2261:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2262:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2262:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2263:Dnah11 UTSW 12 117880025 missense probably benign 0.06
R2263:Dnah11 UTSW 12 117966639 missense probably damaging 0.99
R2328:Dnah11 UTSW 12 117886686 missense probably damaging 0.98
R2352:Dnah11 UTSW 12 117928330 missense probably damaging 1.00
R2410:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R2885:Dnah11 UTSW 12 117987427 nonsense probably null
R3499:Dnah11 UTSW 12 117911023 missense probably damaging 1.00
R3741:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3742:Dnah11 UTSW 12 118131341 missense probably benign 0.05
R3779:Dnah11 UTSW 12 118130713 splice site probably benign
R3785:Dnah11 UTSW 12 118017602 missense probably damaging 1.00
R3883:Dnah11 UTSW 12 117978453 splice site probably benign
R4014:Dnah11 UTSW 12 117974914 missense probably benign 0.16
R4043:Dnah11 UTSW 12 117879943 missense probably damaging 1.00
R4072:Dnah11 UTSW 12 118106492 missense probably damaging 1.00
R4073:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4074:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4076:Dnah11 UTSW 12 118045678 missense probably benign 0.01
R4201:Dnah11 UTSW 12 117966659 missense possibly damaging 0.63
R4224:Dnah11 UTSW 12 118130892 missense probably benign 0.06
R4233:Dnah11 UTSW 12 117916791 missense probably damaging 1.00
R4358:Dnah11 UTSW 12 118125843 nonsense probably null
R4430:Dnah11 UTSW 12 117983011 missense probably benign 0.26
R4465:Dnah11 UTSW 12 117987451 missense probably benign 0.09
R4489:Dnah11 UTSW 12 117916896 missense probably benign 0.31
R4572:Dnah11 UTSW 12 118010125 missense probably benign 0.00
R4574:Dnah11 UTSW 12 118012255 critical splice donor site probably null
R4657:Dnah11 UTSW 12 118192427 missense probably benign 0.02
R4709:Dnah11 UTSW 12 118018760 missense probably benign 0.26
R4740:Dnah11 UTSW 12 118120544 missense probably benign 0.28
R4803:Dnah11 UTSW 12 118127608 missense possibly damaging 0.50
R4896:Dnah11 UTSW 12 117995200 missense probably damaging 1.00
R4908:Dnah11 UTSW 12 118126883 missense probably benign 0.37
R5018:Dnah11 UTSW 12 118130728 missense probably benign 0.00
R5071:Dnah11 UTSW 12 118082453 nonsense probably null
R5074:Dnah11 UTSW 12 118082453 nonsense probably null
R5080:Dnah11 UTSW 12 118198830 start codon destroyed probably null 0.01
R5097:Dnah11 UTSW 12 118017700 missense probably damaging 1.00
R5131:Dnah11 UTSW 12 117954751 missense probably damaging 1.00
R5215:Dnah11 UTSW 12 118157361 missense probably benign 0.09
R5252:Dnah11 UTSW 12 118125941 missense probably damaging 1.00
R5296:Dnah11 UTSW 12 117883416 missense probably damaging 1.00
R5308:Dnah11 UTSW 12 118085680 missense possibly damaging 0.60
R5368:Dnah11 UTSW 12 117954893 missense probably damaging 1.00
R5383:Dnah11 UTSW 12 118085697 missense probably damaging 0.99
R5499:Dnah11 UTSW 12 118106474 missense possibly damaging 0.53
R5503:Dnah11 UTSW 12 117880451 critical splice donor site probably null
R5546:Dnah11 UTSW 12 117975848 missense possibly damaging 0.83
R5578:Dnah11 UTSW 12 118018802 missense probably damaging 0.99
R5657:Dnah11 UTSW 12 117883617 missense probably damaging 1.00
R5702:Dnah11 UTSW 12 118113907 missense probably benign 0.04
R5706:Dnah11 UTSW 12 118023935 missense probably damaging 1.00
R5727:Dnah11 UTSW 12 118127106 missense probably damaging 1.00
R5737:Dnah11 UTSW 12 118192390 missense probably benign
R5884:Dnah11 UTSW 12 118177534 missense probably benign 0.00
R5900:Dnah11 UTSW 12 118082431 splice site probably null
R5905:Dnah11 UTSW 12 117954924 missense probably damaging 1.00
R5928:Dnah11 UTSW 12 117914636 splice site probably null
R5973:Dnah11 UTSW 12 118110952 missense probably benign 0.02
R6024:Dnah11 UTSW 12 118030272 missense probably benign 0.34
R6056:Dnah11 UTSW 12 117928456 missense probably benign 0.03
R6075:Dnah11 UTSW 12 118104851 missense probably damaging 1.00
R6092:Dnah11 UTSW 12 117928456 missense probably benign
R6191:Dnah11 UTSW 12 118190897 missense probably benign
R6197:Dnah11 UTSW 12 118179747 missense probably benign 0.03
R6262:Dnah11 UTSW 12 117931178 missense probably damaging 0.98
R6321:Dnah11 UTSW 12 118142292 missense possibly damaging 0.56
R6454:Dnah11 UTSW 12 117916855 missense probably benign 0.01
R6614:Dnah11 UTSW 12 117886676 missense possibly damaging 0.72
R6694:Dnah11 UTSW 12 118186882 splice site probably null
R6712:Dnah11 UTSW 12 118050722 missense probably damaging 1.00
R6720:Dnah11 UTSW 12 118045646 missense probably damaging 1.00
R6742:Dnah11 UTSW 12 118113894 missense possibly damaging 0.82
R6806:Dnah11 UTSW 12 117987676 splice site probably null
R6895:Dnah11 UTSW 12 117995191 missense probably damaging 0.99
R6939:Dnah11 UTSW 12 118106562 missense probably damaging 1.00
R6940:Dnah11 UTSW 12 118198768 missense probably benign
R6945:Dnah11 UTSW 12 118060310 missense probably damaging 1.00
R6958:Dnah11 UTSW 12 117933809 missense probably damaging 1.00
R6970:Dnah11 UTSW 12 118108944 missense probably benign 0.00
R6976:Dnah11 UTSW 12 118198643 missense probably benign 0.16
R7000:Dnah11 UTSW 12 118017661 missense probably damaging 1.00
R7011:Dnah11 UTSW 12 117922018 frame shift probably null
R7101:Dnah11 UTSW 12 118068145 missense probably benign
R7106:Dnah11 UTSW 12 117961149 missense probably benign 0.15
R7203:Dnah11 UTSW 12 118045522 missense possibly damaging 0.90
R7219:Dnah11 UTSW 12 118041095 missense possibly damaging 0.95
R7219:Dnah11 UTSW 12 118126889 missense probably benign 0.00
R7308:Dnah11 UTSW 12 117995275 missense probably damaging 1.00
R7361:Dnah11 UTSW 12 118018742 missense probably damaging 1.00
R7367:Dnah11 UTSW 12 117987442 missense possibly damaging 0.59
R7399:Dnah11 UTSW 12 118027477 missense probably benign 0.00
R7399:Dnah11 UTSW 12 118125785 missense probably damaging 1.00
R7404:Dnah11 UTSW 12 118104808 missense probably benign 0.36
R7473:Dnah11 UTSW 12 117903176 missense probably benign 0.19
R7545:Dnah11 UTSW 12 117931204 missense probably damaging 1.00
R7608:Dnah11 UTSW 12 118140770 splice site probably null
R7625:Dnah11 UTSW 12 118196642 missense probably benign
R7761:Dnah11 UTSW 12 118023913 missense probably damaging 1.00
R7879:Dnah11 UTSW 12 118041009 missense probably damaging 1.00
R7881:Dnah11 UTSW 12 117987502 missense probably benign 0.04
R7904:Dnah11 UTSW 12 117903268 missense possibly damaging 0.72
R8100:Dnah11 UTSW 12 117966633 missense probably damaging 0.99
R8179:Dnah11 UTSW 12 117878549 missense possibly damaging 0.90
R8192:Dnah11 UTSW 12 118012446 missense probably benign
R8254:Dnah11 UTSW 12 117878524 missense possibly damaging 0.89
R8268:Dnah11 UTSW 12 118027508 nonsense probably null
R8272:Dnah11 UTSW 12 118111017 missense probably benign 0.01
R8344:Dnah11 UTSW 12 118085731 missense probably benign 0.00
R8515:Dnah11 UTSW 12 117975798 missense probably damaging 1.00
R8528:Dnah11 UTSW 12 118008803 missense probably damaging 0.96
R8557:Dnah11 UTSW 12 117878512 missense probably benign
R8676:Dnah11 UTSW 12 118190804 missense probably damaging 1.00
R8773:Dnah11 UTSW 12 117995215 missense possibly damaging 0.94
R8818:Dnah11 UTSW 12 117911029 missense probably damaging 1.00
R8855:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8866:Dnah11 UTSW 12 118192372 missense probably benign 0.03
R8881:Dnah11 UTSW 12 118113912 missense probably benign 0.00
R8881:Dnah11 UTSW 12 118126815 missense probably benign 0.05
R8920:Dnah11 UTSW 12 118113939 missense probably damaging 0.99
R8944:Dnah11 UTSW 12 118127646 missense possibly damaging 0.63
R8945:Dnah11 UTSW 12 118023983 missense probably benign 0.36
R8962:Dnah11 UTSW 12 117952538 missense probably damaging 1.00
R8962:Dnah11 UTSW 12 117954895 missense probably damaging 1.00
R9059:Dnah11 UTSW 12 118130843 missense probably benign 0.00
R9155:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9162:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9164:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9171:Dnah11 UTSW 12 117931183 missense probably damaging 0.99
R9186:Dnah11 UTSW 12 118190897 missense probably benign
R9205:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9208:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9234:Dnah11 UTSW 12 117987360 missense probably damaging 1.00
R9264:Dnah11 UTSW 12 118027527 missense probably damaging 1.00
R9290:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9291:Dnah11 UTSW 12 118027516 missense probably damaging 0.99
R9315:Dnah11 UTSW 12 118179606 missense probably benign 0.11
R9353:Dnah11 UTSW 12 118179699 missense probably benign 0.00
R9375:Dnah11 UTSW 12 117920968 missense possibly damaging 0.67
R9392:Dnah11 UTSW 12 118047320 nonsense probably null
R9392:Dnah11 UTSW 12 118177555 missense probably benign 0.00
R9433:Dnah11 UTSW 12 118012272 missense probably damaging 1.00
R9511:Dnah11 UTSW 12 117914617 missense probably damaging 1.00
R9526:Dnah11 UTSW 12 118186976 missense probably damaging 0.98
R9566:Dnah11 UTSW 12 117974993 missense possibly damaging 0.69
R9673:Dnah11 UTSW 12 118018778 missense possibly damaging 0.91
R9705:Dnah11 UTSW 12 118131035 missense probably damaging 1.00
R9716:Dnah11 UTSW 12 118060413 missense probably damaging 0.99
R9746:Dnah11 UTSW 12 117878576 nonsense probably null
R9764:Dnah11 UTSW 12 117920969 missense probably benign 0.05
RF023:Dnah11 UTSW 12 117954850 missense probably damaging 1.00
RF047:Dnah11 UTSW 12 118010083 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117895012 missense probably damaging 1.00
Z1088:Dnah11 UTSW 12 117982969 missense probably damaging 1.00
Z1176:Dnah11 UTSW 12 117931177 missense possibly damaging 0.81
Z1176:Dnah11 UTSW 12 118127119 missense probably benign 0.00
Z1176:Dnah11 UTSW 12 118130799 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTAAATGAGAGAACCTGGGCAC -3'
(R):5'- TCACAGTGGGATCAGAAGCC -3'

Sequencing Primer
(F):5'- ACAGGCCAGGAGCTTCTTG -3'
(R):5'- GCCAGGGTTTTTGTACAGTAAGAAAC -3'
Posted On 2021-03-08