Incidental Mutation 'R8738:Gcm2'
ID 663185
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Name glial cells missing homolog 2
Synonyms Gcm1-rs2
MMRRC Submission 068585-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 41254903-41264511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41258096 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 177 (R177S)
Ref Sequence ENSEMBL: ENSMUSP00000021791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791] [ENSMUST00000225271]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021791
AA Change: R177S

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: R177S

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225271
AA Change: R177S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,196,214 (GRCm39) T283M probably damaging Het
Abca9 A G 11: 110,056,817 (GRCm39) M1T probably null Het
Ackr1 T C 1: 173,159,952 (GRCm39) Y189C probably damaging Het
Acsm4 A G 7: 119,304,264 (GRCm39) D303G probably benign Het
Arfgef2 A T 2: 166,708,867 (GRCm39) M1060L probably benign Het
Arhgef40 T A 14: 52,238,414 (GRCm39) F1298I probably damaging Het
Atg2a T C 19: 6,306,674 (GRCm39) I1453T probably benign Het
B4galnt1 A T 10: 127,007,584 (GRCm39) D495V probably benign Het
Brpf3 T A 17: 29,040,214 (GRCm39) D878E probably benign Het
C3 A G 17: 57,511,015 (GRCm39) *1664R probably null Het
Cap2 A G 13: 46,684,548 (GRCm39) T73A probably benign Het
Ccr6 A T 17: 8,475,394 (GRCm39) I200F probably damaging Het
Cdc42bpb C T 12: 111,274,221 (GRCm39) G1021R probably benign Het
Cidea C A 18: 67,499,485 (GRCm39) S124* probably null Het
Cnst C A 1: 179,420,274 (GRCm39) T135K probably benign Het
Crebbp A T 16: 3,936,952 (GRCm39) M805K probably benign Het
Crybb1 A G 5: 112,411,439 (GRCm39) Y119C probably damaging Het
Cux1 G T 5: 136,402,220 (GRCm39) T121K probably damaging Het
Dnah11 A T 12: 118,049,384 (GRCm39) probably null Het
Dnmbp T C 19: 43,900,677 (GRCm39) T48A probably damaging Het
Dysf G A 6: 84,171,353 (GRCm39) G1787E probably damaging Het
Gdf6 G T 4: 9,859,429 (GRCm39) R170S probably damaging Het
Gm16686 A T 4: 88,673,775 (GRCm39) M18K unknown Het
Gm36864 C T 7: 43,886,304 (GRCm39) Q179* probably null Het
Golgb1 A G 16: 36,736,675 (GRCm39) D2015G probably damaging Het
Gtf2i A G 5: 134,324,374 (GRCm39) L30P probably damaging Het
Herc2 A G 7: 55,798,402 (GRCm39) E1955G possibly damaging Het
Hes3 A T 4: 152,372,132 (GRCm39) D37E probably damaging Het
Igha A G 12: 113,223,144 (GRCm39) V161A probably damaging Het
Isl2 T G 9: 55,452,722 (GRCm39) S327A probably benign Het
Itk A G 11: 46,231,539 (GRCm39) L339P probably damaging Het
Kcnb2 T C 1: 15,780,648 (GRCm39) S507P probably benign Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lhfpl4 C A 6: 113,171,034 (GRCm39) V51L possibly damaging Het
Lhpp A G 7: 132,243,261 (GRCm39) Y159C probably damaging Het
Lrwd1 C A 5: 136,162,257 (GRCm39) E159* probably null Het
Map3k13 A G 16: 21,745,008 (GRCm39) T856A probably damaging Het
Mcm8 A G 2: 132,665,141 (GRCm39) T206A probably benign Het
Megf6 A G 4: 154,352,436 (GRCm39) K1265R probably benign Het
Mrgprb2 A G 7: 48,202,648 (GRCm39) Y26H probably benign Het
Mug1 T C 6: 121,817,208 (GRCm39) probably benign Het
Mysm1 C T 4: 94,856,196 (GRCm39) G134S probably damaging Het
Nlrp3 A C 11: 59,440,216 (GRCm39) I598L probably benign Het
Npas2 A T 1: 39,331,797 (GRCm39) I71F possibly damaging Het
Nr1h5 A G 3: 102,862,015 (GRCm39) S85P probably benign Het
Nrcam T A 12: 44,619,075 (GRCm39) V868D possibly damaging Het
Oas1a A G 5: 121,040,019 (GRCm39) F191L probably damaging Het
Or14j8 A T 17: 38,263,673 (GRCm39) Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 (GRCm39) L125H possibly damaging Het
Osbpl7 A G 11: 96,946,903 (GRCm39) E402G possibly damaging Het
Otof G A 5: 30,545,968 (GRCm39) Q462* probably null Het
Phlda2 A C 7: 143,055,959 (GRCm39) I90S probably damaging Het
Plin3 C T 17: 56,593,490 (GRCm39) V75I probably benign Het
Pms1 A T 1: 53,321,195 (GRCm39) S13T possibly damaging Het
Ppm1d A G 11: 85,236,732 (GRCm39) K504E probably damaging Het
Rflna A T 5: 125,087,541 (GRCm39) I93F probably damaging Het
Rnpc3 T A 3: 113,414,805 (GRCm39) M193L probably benign Het
Sema3e A T 5: 14,214,169 (GRCm39) I145F possibly damaging Het
Serpinb1b C A 13: 33,271,500 (GRCm39) N90K probably damaging Het
Sfswap A G 5: 129,620,345 (GRCm39) D538G possibly damaging Het
Snx14 A T 9: 88,289,453 (GRCm39) D266E possibly damaging Het
Stat4 C T 1: 52,115,711 (GRCm39) T217M possibly damaging Het
Taf13 T C 3: 108,485,444 (GRCm39) M40T probably damaging Het
Tenm4 A G 7: 96,523,047 (GRCm39) T1530A probably damaging Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tnfrsf14 T C 4: 155,007,710 (GRCm39) I220M possibly damaging Het
Tnk2 T C 16: 32,484,718 (GRCm39) W60R probably damaging Het
Tph2 A T 10: 115,015,614 (GRCm39) probably benign Het
Unc13b A T 4: 43,177,564 (GRCm39) K2797N unknown Het
Upf1 C G 8: 70,785,973 (GRCm39) M995I probably benign Het
Upf1 G A 8: 70,785,972 (GRCm39) P996S probably benign Het
Vcan C T 13: 89,840,439 (GRCm39) V1702M probably benign Het
Vmn2r57 T C 7: 41,077,020 (GRCm39) D382G probably benign Het
Xxylt1 C T 16: 30,899,964 (GRCm39) A64T probably benign Het
Zcchc8 A G 5: 123,841,070 (GRCm39) S407P probably damaging Het
Zdhhc19 T A 16: 32,317,187 (GRCm39) F109Y probably damaging Het
Zfp638 T C 6: 83,931,745 (GRCm39) probably null Het
Zfp691 A G 4: 119,027,861 (GRCm39) S124P probably damaging Het
Zfp804a T A 2: 82,089,450 (GRCm39) V1093D probably damaging Het
Zfp986 A C 4: 145,625,550 (GRCm39) Q70P probably benign Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41,256,607 (GRCm39) missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41,259,217 (GRCm39) missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41,259,269 (GRCm39) missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41,258,125 (GRCm39) missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41,256,477 (GRCm39) missense probably benign 0.01
IGL03142:Gcm2 APN 13 41,256,711 (GRCm39) missense probably benign 0.01
IGL03184:Gcm2 APN 13 41,258,888 (GRCm39) missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41,256,315 (GRCm39) missense probably benign 0.01
R0227:Gcm2 UTSW 13 41,259,332 (GRCm39) missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41,259,347 (GRCm39) missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41,259,367 (GRCm39) missense probably benign 0.19
R2057:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41,263,430 (GRCm39) start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41,257,094 (GRCm39) missense probably benign 0.02
R4653:Gcm2 UTSW 13 41,256,317 (GRCm39) missense probably benign 0.21
R4782:Gcm2 UTSW 13 41,256,970 (GRCm39) missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41,256,970 (GRCm39) missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41,256,435 (GRCm39) missense probably benign
R5162:Gcm2 UTSW 13 41,257,131 (GRCm39) missense probably benign 0.01
R5665:Gcm2 UTSW 13 41,263,387 (GRCm39) missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41,263,372 (GRCm39) missense probably damaging 1.00
R5771:Gcm2 UTSW 13 41,256,991 (GRCm39) missense probably benign 0.40
R5928:Gcm2 UTSW 13 41,256,874 (GRCm39) missense probably benign 0.00
R5977:Gcm2 UTSW 13 41,256,603 (GRCm39) missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41,263,373 (GRCm39) missense probably damaging 1.00
R6578:Gcm2 UTSW 13 41,259,154 (GRCm39) missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41,259,361 (GRCm39) missense probably damaging 1.00
R7088:Gcm2 UTSW 13 41,256,840 (GRCm39) missense probably damaging 0.98
R7413:Gcm2 UTSW 13 41,259,230 (GRCm39) missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41,256,751 (GRCm39) missense probably benign 0.02
R8293:Gcm2 UTSW 13 41,256,646 (GRCm39) missense probably damaging 1.00
R9087:Gcm2 UTSW 13 41,263,406 (GRCm39) missense
R9316:Gcm2 UTSW 13 41,259,328 (GRCm39) missense probably damaging 1.00
R9799:Gcm2 UTSW 13 41,258,924 (GRCm39) missense probably damaging 1.00
Z1088:Gcm2 UTSW 13 41,256,268 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCAACGATGTTTGCTAGAAG -3'
(R):5'- GGGTTGCCAGCTAGTTTCTAAG -3'

Sequencing Primer
(F):5'- AGTGAACACAGACCTCTG -3'
(R):5'- CTGGAACTCACTATGTAGCCTAGG -3'
Posted On 2021-03-08