Incidental Mutation 'R8738:Arhgef40'
ID 663188
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor (GEF) 40
Synonyms E130112L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 51984719-52006251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 52000957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1298 (F1298I)
Ref Sequence ENSEMBL: ENSMUSP00000091331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
AlphaFold Q3UPH7
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: F1298I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: F1298I

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: F1298I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: F1298I

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: F1298I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: F1298I

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect probably benign
Transcript: ENSMUST00000182667
Predicted Effect possibly damaging
Transcript: ENSMUST00000182760
AA Change: F1307I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: F1307I

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182828
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: F1298I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: F1298I

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dnmbp T C 19: 43,912,238 T48A probably damaging Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mug1 T C 6: 121,840,249 probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Tph2 A T 10: 115,179,709 probably benign Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 51991797 missense unknown
R7857:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 51987575 missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 51984995 splice site probably benign
R8144:Arhgef40 UTSW 14 51998175 missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 51988769 missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 51989400 missense probably benign 0.00
R8830:Arhgef40 UTSW 14 52003708 missense probably damaging 1.00
R9038:Arhgef40 UTSW 14 51997615 missense probably damaging 0.96
R9712:Arhgef40 UTSW 14 51988958 missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCCATTAGACCCCTTTC -3'
(R):5'- CTAGCACCCTAGAAGCGATGAC -3'

Sequencing Primer
(F):5'- ATTAGACCCCTTTCCCTCTAAATC -3'
(R):5'- CACCCTAGAAGCGATGACTAAAAGG -3'
Posted On 2021-03-08