Mutagenetix > Incidental Mutation

Incidental Mutation 'R8738:Atg2a'

663201

Institutional Source

Beutler Lab

Gene Symbol

Atg2a

Ensembl Gene

ENSMUSG00000024773

Gene Name

autophagy related 2A

Synonyms

MMRRC Submission

068585-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.377) question?

Stock #

R8738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6241668-6262335 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 6256644 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1453 (I1453T)

Ref Sequence

ENSEMBL: ENSMUSP00000046412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045351]

AlphaFold

Q6P4T0

Predicted Effect

probably benign
Transcript: ENSMUST00000045351
AA Change: I1453T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000046412
Gene: ENSMUSG00000024773
AA Change: I1453T

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	14	131	7.6e-20	PFAM
low complexity region	138	154	N/A	INTRINSIC
low complexity region	285	301	N/A	INTRINSIC
low complexity region	501	512	N/A	INTRINSIC
low complexity region	852	863	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1761	1773	N/A	INTRINSIC
Pfam:ATG_C	1814	1908	2.2e-31	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114998
Gene: ENSMUSG00000024773
AA Change: I1256T

Domain	Start	End	E-Value	Type
low complexity region	87	103	N/A	INTRINSIC
low complexity region	303	314	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	871	883	N/A	INTRINSIC
low complexity region	1233	1250	N/A	INTRINSIC
low complexity region	1565	1577	N/A	INTRINSIC
Pfam:ATG_C	1618	1712	3.6e-32	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (76/78)

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	G	A	9: 15,284,918	T283M	probably damaging	Het
Abca9	A	G	11: 110,165,991	M1T	probably null	Het
Ackr1	T	C	1: 173,332,385	Y189C	probably damaging	Het
Acsm4	A	G	7: 119,705,041	D303G	probably benign	Het
Arfgef2	A	T	2: 166,866,947	M1060L	probably benign	Het
Arhgef40	T	A	14: 52,000,957	F1298I	probably damaging	Het
B4galnt1	A	T	10: 127,171,715	D495V	probably benign	Het
Brpf3	T	A	17: 28,821,240	D878E	probably benign	Het
C3	A	G	17: 57,204,015	*1664R	probably null	Het
Cap2	A	G	13: 46,531,072	T73A	probably benign	Het
Ccr6	A	T	17: 8,256,562	I200F	probably damaging	Het
Cdc42bpb	C	T	12: 111,307,787	G1021R	probably benign	Het
Cidea	C	A	18: 67,366,415	S124*	probably null	Het
Cnst	C	A	1: 179,592,709	T135K	probably benign	Het
Crebbp	A	T	16: 4,119,088	M805K	probably benign	Het
Crybb1	A	G	5: 112,263,573	Y119C	probably damaging	Het
Cux1	G	T	5: 136,373,366	T121K	probably damaging	Het
Dnah11	A	T	12: 118,085,649		probably null	Het
Dnmbp	T	C	19: 43,912,238	T48A	probably damaging	Het
Dysf	G	A	6: 84,194,371	G1787E	probably damaging	Het
Gcm2	T	A	13: 41,104,620	R177S	probably benign	Het
Gdf6	G	T	4: 9,859,429	R170S	probably damaging	Het
Gm16686	A	T	4: 88,755,538	M18K	unknown	Het
Gm36864	C	T	7: 44,236,880	Q179*	probably null	Het
Golgb1	A	G	16: 36,916,313	D2015G	probably damaging	Het
Gtf2i	A	G	5: 134,295,520	L30P	probably damaging	Het
Herc2	A	G	7: 56,148,654	E1955G	possibly damaging	Het
Hes3	A	T	4: 152,287,675	D37E	probably damaging	Het
Igha	A	G	12: 113,259,524	V161A	probably damaging	Het
Isl2	T	G	9: 55,545,438	S327A	probably benign	Het
Itk	A	G	11: 46,340,712	L339P	probably damaging	Het
Kcnb2	T	C	1: 15,710,424	S507P	probably benign	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lhfpl4	C	A	6: 113,194,073	V51L	possibly damaging	Het
Lhpp	A	G	7: 132,641,532	Y159C	probably damaging	Het
Lrwd1	C	A	5: 136,133,403	E159*	probably null	Het
Map3k13	A	G	16: 21,926,258	T856A	probably damaging	Het
Mcm8	A	G	2: 132,823,221	T206A	probably benign	Het
Megf6	A	G	4: 154,267,979	K1265R	probably benign	Het
Mrgprb2	A	G	7: 48,552,900	Y26H	probably benign	Het
Mug1	T	C	6: 121,840,249		probably benign	Het
Mysm1	C	T	4: 94,967,959	G134S	probably damaging	Het
Nlrp3	A	C	11: 59,549,390	I598L	probably benign	Het
Npas2	A	T	1: 39,292,716	I71F	possibly damaging	Het
Nr1h5	A	G	3: 102,954,699	S85P	probably benign	Het
Nrcam	T	A	12: 44,572,292	V868D	possibly damaging	Het
Oas1a	A	G	5: 120,901,956	F191L	probably damaging	Het
Olfr761	A	T	17: 37,952,782	Y81N	possibly damaging	Het
Orc3	A	T	4: 34,599,778	L125H	possibly damaging	Het
Osbpl7	A	G	11: 97,056,077	E402G	possibly damaging	Het
Otof	G	A	5: 30,388,624	Q462*	probably null	Het
Phlda2	A	C	7: 143,502,222	I90S	probably damaging	Het
Plin3	C	T	17: 56,286,490	V75I	probably benign	Het
Pms1	A	T	1: 53,282,036	S13T	possibly damaging	Het
Ppm1d	A	G	11: 85,345,906	K504E	probably damaging	Het
Rflna	A	T	5: 125,010,477	I93F	probably damaging	Het
Rnpc3	T	A	3: 113,621,156	M193L	probably benign	Het
Sema3e	A	T	5: 14,164,155	I145F	possibly damaging	Het
Serpinb1b	C	A	13: 33,087,517	N90K	probably damaging	Het
Sfswap	A	G	5: 129,543,281	D538G	possibly damaging	Het
Snx14	A	T	9: 88,407,400	D266E	possibly damaging	Het
Stat4	C	T	1: 52,076,552	T217M	possibly damaging	Het
Taf13	T	C	3: 108,578,128	M40T	probably damaging	Het
Tenm4	A	G	7: 96,873,840	T1530A	probably damaging	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tnfrsf14	T	C	4: 154,923,253	I220M	possibly damaging	Het
Tnk2	T	C	16: 32,665,900	W60R	probably damaging	Het
Tph2	A	T	10: 115,179,709		probably benign	Het
Unc13b	A	T	4: 43,177,564	K2797N	unknown	Het
Upf1	G	A	8: 70,333,322	P996S	probably benign	Het
Upf1	C	G	8: 70,333,323	M995I	probably benign	Het
Vcan	C	T	13: 89,692,320	V1702M	probably benign	Het
Vmn2r57	T	C	7: 41,427,596	D382G	probably benign	Het
Xxylt1	C	T	16: 31,081,146	A64T	probably benign	Het
Zcchc8	A	G	5: 123,703,007	S407P	probably damaging	Het
Zdhhc19	T	A	16: 32,498,369	F109Y	probably damaging	Het
Zfp638	T	C	6: 83,954,763		probably null	Het
Zfp691	A	G	4: 119,170,664	S124P	probably damaging	Het
Zfp804a	T	A	2: 82,259,106	V1093D	probably damaging	Het
Zfp986	A	C	4: 145,898,980	Q70P	probably benign	Het

Other mutations in Atg2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Atg2a	APN	19	6254599	missense	probably damaging	1.00
IGL01612:Atg2a	APN	19	6252484	missense	probably benign	0.03
IGL02105:Atg2a	APN	19	6250403	splice site	probably benign
IGL02151:Atg2a	APN	19	6255757	missense	possibly damaging	0.95
IGL02228:Atg2a	APN	19	6246800	missense	probably benign	0.29
IGL02329:Atg2a	APN	19	6249929	critical splice donor site	probably null
IGL02408:Atg2a	APN	19	6241828	nonsense	probably null
IGL02538:Atg2a	APN	19	6257628	missense	probably benign
IGL02830:Atg2a	APN	19	6247681	missense	probably benign	0.04
IGL03349:Atg2a	APN	19	6258024	missense	possibly damaging	0.77
PIT4515001:Atg2a	UTSW	19	6253585	missense	probably damaging	1.00
R0099:Atg2a	UTSW	19	6252789	missense	probably damaging	0.97
R0212:Atg2a	UTSW	19	6246554	missense	probably damaging	1.00
R0365:Atg2a	UTSW	19	6247683	missense	possibly damaging	0.51
R0398:Atg2a	UTSW	19	6246578	missense	probably damaging	1.00
R0483:Atg2a	UTSW	19	6256601	missense	probably damaging	0.98
R0483:Atg2a	UTSW	19	6256602	missense	probably benign	0.01
R0494:Atg2a	UTSW	19	6253377	missense	probably damaging	1.00
R0511:Atg2a	UTSW	19	6252539	missense	possibly damaging	0.89
R0590:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0592:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0593:Atg2a	UTSW	19	6245007	unclassified	probably benign
R0630:Atg2a	UTSW	19	6244517	missense	probably damaging	0.99
R1306:Atg2a	UTSW	19	6253021	missense	probably benign	0.31
R1437:Atg2a	UTSW	19	6250616	missense	probably damaging	1.00
R1539:Atg2a	UTSW	19	6246771	splice site	probably null
R1774:Atg2a	UTSW	19	6250598	missense	probably benign	0.01
R1781:Atg2a	UTSW	19	6256213	missense	probably damaging	0.96
R1854:Atg2a	UTSW	19	6252431	missense	probably benign	0.11
R1884:Atg2a	UTSW	19	6254384	missense	probably damaging	1.00
R1899:Atg2a	UTSW	19	6245067	missense	probably damaging	1.00
R1935:Atg2a	UTSW	19	6252536	missense	probably damaging	1.00
R2020:Atg2a	UTSW	19	6250269	critical splice donor site	probably null
R2071:Atg2a	UTSW	19	6257458	missense	probably benign	0.00
R2513:Atg2a	UTSW	19	6258046	critical splice donor site	probably null
R3808:Atg2a	UTSW	19	6252816	missense	possibly damaging	0.71
R4065:Atg2a	UTSW	19	6258366	missense	probably damaging	1.00
R4109:Atg2a	UTSW	19	6258374	missense	possibly damaging	0.95
R4352:Atg2a	UTSW	19	6257457	missense	probably benign	0.04
R4440:Atg2a	UTSW	19	6255829	critical splice donor site	probably null
R4472:Atg2a	UTSW	19	6258955	missense	probably damaging	0.98
R4669:Atg2a	UTSW	19	6258987	critical splice donor site	probably null
R4878:Atg2a	UTSW	19	6250244	missense	probably damaging	1.00
R4926:Atg2a	UTSW	19	6257533	missense	probably damaging	0.96
R5237:Atg2a	UTSW	19	6246814	missense	probably benign
R5350:Atg2a	UTSW	19	6251338	missense	probably damaging	0.99
R5507:Atg2a	UTSW	19	6245070	missense	possibly damaging	0.94
R5732:Atg2a	UTSW	19	6257460	missense	probably damaging	1.00
R5784:Atg2a	UTSW	19	6261505	missense	probably damaging	1.00
R5960:Atg2a	UTSW	19	6254360	missense	probably damaging	1.00
R5985:Atg2a	UTSW	19	6254637	missense	probably damaging	1.00
R6175:Atg2a	UTSW	19	6241729	unclassified	probably benign
R6572:Atg2a	UTSW	19	6254665	missense	probably damaging	0.98
R6878:Atg2a	UTSW	19	6250178	missense	probably damaging	0.99
R6879:Atg2a	UTSW	19	6251852	missense	possibly damaging	0.70
R6983:Atg2a	UTSW	19	6260040	missense	probably damaging	0.99
R7024:Atg2a	UTSW	19	6250219	missense	possibly damaging	0.88
R7217:Atg2a	UTSW	19	6253441	critical splice donor site	probably null
R7384:Atg2a	UTSW	19	6261677	missense	probably damaging	1.00
R7387:Atg2a	UTSW	19	6255168	missense	possibly damaging	0.79
R7425:Atg2a	UTSW	19	6255652	missense	probably benign	0.02
R7512:Atg2a	UTSW	19	6260076	missense	probably damaging	1.00
R7658:Atg2a	UTSW	19	6251263	missense	probably damaging	1.00
R7893:Atg2a	UTSW	19	6251296	missense	probably damaging	1.00
R8062:Atg2a	UTSW	19	6252579	critical splice donor site	probably null
R8258:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8259:Atg2a	UTSW	19	6249829	missense	probably damaging	0.98
R8350:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8412:Atg2a	UTSW	19	6244524	missense	probably damaging	1.00
R8450:Atg2a	UTSW	19	6246811	missense	probably benign	0.03
R8474:Atg2a	UTSW	19	6251403	critical splice donor site	probably null
R8501:Atg2a	UTSW	19	6254390	missense	probably damaging	1.00
R8786:Atg2a	UTSW	19	6244430	missense	probably damaging	1.00
R8810:Atg2a	UTSW	19	6250621	missense	probably benign	0.01
R8898:Atg2a	UTSW	19	6256691	splice site	probably benign
R9016:Atg2a	UTSW	19	6250081	missense	probably damaging	1.00
R9111:Atg2a	UTSW	19	6261504	missense	probably damaging	1.00
R9177:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9184:Atg2a	UTSW	19	6241857	missense	probably damaging	1.00
R9268:Atg2a	UTSW	19	6241875	missense	probably damaging	1.00
R9496:Atg2a	UTSW	19	6259992	missense	possibly damaging	0.63
R9570:Atg2a	UTSW	19	6255719	missense	probably benign	0.03
R9642:Atg2a	UTSW	19	6250168	nonsense	probably null
X0065:Atg2a	UTSW	19	6258196	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CATAGCCTAGCTACGACCTCAG -3'
(R):5'- ACATAGCCTGGAACCTGTGG -3'

Sequencing Primer
(F):5'- TAGCTACGACCTCAGGCCTC -3'
(R):5'- GGAACCTGTGGCTCCTGCTATC -3'

Posted On

2021-03-08