Incidental Mutation 'R8738:Dnmbp'
ID 663202
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8738 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43912238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 48 (T48A)
Ref Sequence ENSEMBL: ENSMUSP00000026209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212396]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026209
AA Change: T48A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: T48A

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212032
AA Change: T48A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000212396
AA Change: T48A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,284,918 T283M probably damaging Het
Abca9 A G 11: 110,165,991 M1T probably null Het
Ackr1 T C 1: 173,332,385 Y189C probably damaging Het
Acsm4 A G 7: 119,705,041 D303G probably benign Het
Arfgef2 A T 2: 166,866,947 M1060L probably benign Het
Arhgef40 T A 14: 52,000,957 F1298I probably damaging Het
Atg2a T C 19: 6,256,644 I1453T probably benign Het
B4galnt1 A T 10: 127,171,715 D495V probably benign Het
Brpf3 T A 17: 28,821,240 D878E probably benign Het
C3 A G 17: 57,204,015 *1664R probably null Het
Cap2 A G 13: 46,531,072 T73A probably benign Het
Ccr6 A T 17: 8,256,562 I200F probably damaging Het
Cdc42bpb C T 12: 111,307,787 G1021R probably benign Het
Cidea C A 18: 67,366,415 S124* probably null Het
Cnst C A 1: 179,592,709 T135K probably benign Het
Crebbp A T 16: 4,119,088 M805K probably benign Het
Crybb1 A G 5: 112,263,573 Y119C probably damaging Het
Cux1 G T 5: 136,373,366 T121K probably damaging Het
Dnah11 A T 12: 118,085,649 probably null Het
Dysf G A 6: 84,194,371 G1787E probably damaging Het
Gcm2 T A 13: 41,104,620 R177S probably benign Het
Gdf6 G T 4: 9,859,429 R170S probably damaging Het
Gm16686 A T 4: 88,755,538 M18K unknown Het
Gm36864 C T 7: 44,236,880 Q179* probably null Het
Golgb1 A G 16: 36,916,313 D2015G probably damaging Het
Gtf2i A G 5: 134,295,520 L30P probably damaging Het
Herc2 A G 7: 56,148,654 E1955G possibly damaging Het
Hes3 A T 4: 152,287,675 D37E probably damaging Het
Igha A G 12: 113,259,524 V161A probably damaging Het
Isl2 T G 9: 55,545,438 S327A probably benign Het
Itk A G 11: 46,340,712 L339P probably damaging Het
Kcnb2 T C 1: 15,710,424 S507P probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lhfpl4 C A 6: 113,194,073 V51L possibly damaging Het
Lhpp A G 7: 132,641,532 Y159C probably damaging Het
Lrwd1 C A 5: 136,133,403 E159* probably null Het
Map3k13 A G 16: 21,926,258 T856A probably damaging Het
Mcm8 A G 2: 132,823,221 T206A probably benign Het
Megf6 A G 4: 154,267,979 K1265R probably benign Het
Mrgprb2 A G 7: 48,552,900 Y26H probably benign Het
Mug1 T C 6: 121,840,249 probably benign Het
Mysm1 C T 4: 94,967,959 G134S probably damaging Het
Nlrp3 A C 11: 59,549,390 I598L probably benign Het
Npas2 A T 1: 39,292,716 I71F possibly damaging Het
Nr1h5 A G 3: 102,954,699 S85P probably benign Het
Nrcam T A 12: 44,572,292 V868D possibly damaging Het
Oas1a A G 5: 120,901,956 F191L probably damaging Het
Olfr761 A T 17: 37,952,782 Y81N possibly damaging Het
Orc3 A T 4: 34,599,778 L125H possibly damaging Het
Osbpl7 A G 11: 97,056,077 E402G possibly damaging Het
Otof G A 5: 30,388,624 Q462* probably null Het
Phlda2 A C 7: 143,502,222 I90S probably damaging Het
Plin3 C T 17: 56,286,490 V75I probably benign Het
Pms1 A T 1: 53,282,036 S13T possibly damaging Het
Ppm1d A G 11: 85,345,906 K504E probably damaging Het
Rflna A T 5: 125,010,477 I93F probably damaging Het
Rnpc3 T A 3: 113,621,156 M193L probably benign Het
Sema3e A T 5: 14,164,155 I145F possibly damaging Het
Serpinb1b C A 13: 33,087,517 N90K probably damaging Het
Sfswap A G 5: 129,543,281 D538G possibly damaging Het
Snx14 A T 9: 88,407,400 D266E possibly damaging Het
Stat4 C T 1: 52,076,552 T217M possibly damaging Het
Taf13 T C 3: 108,578,128 M40T probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tenm4 A G 7: 96,873,840 T1530A probably damaging Het
Tnfrsf14 T C 4: 154,923,253 I220M possibly damaging Het
Tnk2 T C 16: 32,665,900 W60R probably damaging Het
Tph2 A T 10: 115,179,709 probably benign Het
Unc13b A T 4: 43,177,564 K2797N unknown Het
Upf1 G A 8: 70,333,322 P996S probably benign Het
Upf1 C G 8: 70,333,323 M995I probably benign Het
Vcan C T 13: 89,692,320 V1702M probably benign Het
Vmn2r57 T C 7: 41,427,596 D382G probably benign Het
Xxylt1 C T 16: 31,081,146 A64T probably benign Het
Zcchc8 A G 5: 123,703,007 S407P probably damaging Het
Zdhhc19 T A 16: 32,498,369 F109Y probably damaging Het
Zfp638 T C 6: 83,954,763 probably null Het
Zfp691 A G 4: 119,170,664 S124P probably damaging Het
Zfp804a T A 2: 82,259,106 V1093D probably damaging Het
Zfp986 A C 4: 145,898,980 Q70P probably benign Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCAGAAGCATCGCTCCTACTAG -3'
(R):5'- TTATGTGGCACGTCTCCTGC -3'

Sequencing Primer
(F):5'- GCATCGCTCCTACTAGAAATCTATTC -3'
(R):5'- AGCGCCGCTCTCTCACAC -3'
Posted On 2021-03-08