Incidental Mutation 'R8739:Chrnb2'
ID663211
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R8739 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89762439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000200558]
Predicted Effect probably benign
Transcript: ENSMUST00000029562
AA Change: S109P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950
AA Change: S109P

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200558
AA Change: S109P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950
AA Change: S109P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T C 8: 40,680,441 V316A possibly damaging Het
Adamts9 T C 6: 92,854,280 E1364G probably benign Het
Agrn C T 4: 156,172,588 R1233Q probably benign Het
Ankrd6 A G 4: 32,806,337 S639P possibly damaging Het
Arid5a A G 1: 36,319,596 N418S probably benign Het
Cep152 T C 2: 125,620,055 E69G probably benign Het
Chuk A G 19: 44,088,696 S404P probably benign Het
Clec4a3 T C 6: 122,967,549 Y185H probably damaging Het
Dctd T A 8: 48,138,848 L149H probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dnah5 G A 15: 28,345,860 A2449T probably benign Het
Dync1h1 T C 12: 110,614,580 V247A probably damaging Het
Espnl T A 1: 91,344,595 L559Q probably damaging Het
Gak A G 5: 108,591,738 V627A possibly damaging Het
Gcnt1 A T 19: 17,330,073 M96K probably benign Het
Ggta1 T C 2: 35,402,560 D245G probably damaging Het
Gm15448 A T 7: 3,825,189 S40T Het
Hfm1 A T 5: 106,898,505 F505Y probably damaging Het
Kcnj14 C G 7: 45,819,388 R231P probably damaging Het
Lamc2 A T 1: 153,144,653 C382* probably null Het
Marveld3 T C 8: 109,961,977 E44G possibly damaging Het
Mettl17 T C 14: 51,891,391 F373L possibly damaging Het
Morc3 T A 16: 93,860,510 L374Q probably damaging Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Myo15 A G 11: 60,477,262 N283D probably benign Het
Ncapg2 T G 12: 116,415,478 D197E possibly damaging Het
Nipbl T C 15: 8,303,420 T2240A probably benign Het
Nrip1 A C 16: 76,291,348 V1107G possibly damaging Het
Olfr1275 C A 2: 111,231,489 M101I probably benign Het
Olfr525 T C 7: 140,322,734 F12L probably damaging Het
Olfr984 G A 9: 40,101,340 T50I probably benign Het
Pcdhb11 T A 18: 37,422,496 I293K probably damaging Het
Pcsk5 G T 19: 17,454,774 H1492Q probably benign Het
Pdcd4 T A 19: 53,910,974 Y131* probably null Het
Pdf T A 8: 107,047,164 M216L probably damaging Het
Plch1 T C 3: 63,870,685 H17R possibly damaging Het
Prkdc T G 16: 15,808,204 S3365A probably benign Het
Rab3c T C 13: 110,260,601 T44A probably damaging Het
Rad17 T C 13: 100,629,490 T377A probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf215 T G 11: 4,135,959 probably null Het
Sec31b G A 19: 44,519,181 T808I probably benign Het
Selenbp1 A T 3: 94,937,290 D86V probably damaging Het
Smurf2 G T 11: 106,852,496 Y241* probably null Het
Spint1 T C 2: 119,248,805 V456A possibly damaging Het
Stx5a A T 19: 8,748,560 I175F probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tfb1m T C 17: 3,519,652 E313G probably benign Het
Theg G T 10: 79,583,747 N240K possibly damaging Het
Thrb A G 14: 17,963,082 D15G probably benign Het
Tln2 T C 9: 67,258,273 K1045R probably damaging Het
Trabd T C 15: 89,084,949 I192T probably damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
Ttc21a A G 9: 119,967,305 N1263S probably benign Het
Ttll13 T C 7: 80,253,175 I197T probably damaging Het
Virma T C 4: 11,540,643 probably null Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R2124:Chrnb2 UTSW 3 89769341 unclassified probably benign
R3548:Chrnb2 UTSW 3 89761591 missense probably benign 0.04
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R6999:Chrnb2 UTSW 3 89761315 missense possibly damaging 0.71
R7318:Chrnb2 UTSW 3 89763367 critical splice acceptor site probably null
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
R8025:Chrnb2 UTSW 3 89761342 missense probably damaging 1.00
R8094:Chrnb2 UTSW 3 89761391 missense probably damaging 1.00
R8143:Chrnb2 UTSW 3 89747323 missense unknown
R8809:Chrnb2 UTSW 3 89757150 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGCATCCCACTAGTTGG -3'
(R):5'- CACTGTGCAGAGAAGGCTAG -3'

Sequencing Primer
(F):5'- TTGTGGATAACGCCTGCC -3'
(R):5'- GAGAAGGCTAGCCATATGAGTTTTCC -3'
Posted On2021-03-08