Incidental Mutation 'R8739:Hfm1'
ID663216
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8739 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106898505 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 505 (F505Y)
Ref Sequence ENSEMBL: ENSMUSP00000108310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495] [ENSMUST00000148686] [ENSMUST00000200249]
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: F505Y

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: F505Y

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: F505Y

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: F505Y

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 T C 8: 40,680,441 V316A possibly damaging Het
Adamts9 T C 6: 92,854,280 E1364G probably benign Het
Agrn C T 4: 156,172,588 R1233Q probably benign Het
Ankrd6 A G 4: 32,806,337 S639P possibly damaging Het
Arid5a A G 1: 36,319,596 N418S probably benign Het
Cep152 T C 2: 125,620,055 E69G probably benign Het
Chrnb2 A G 3: 89,762,439 S109P probably damaging Het
Chuk A G 19: 44,088,696 S404P probably benign Het
Clec4a3 T C 6: 122,967,549 Y185H probably damaging Het
Dctd T A 8: 48,138,848 L149H probably benign Het
Dhrs13 G C 11: 78,032,666 R70P possibly damaging Het
Dnah5 G A 15: 28,345,860 A2449T probably benign Het
Dync1h1 T C 12: 110,614,580 V247A probably damaging Het
Espnl T A 1: 91,344,595 L559Q probably damaging Het
Gak A G 5: 108,591,738 V627A possibly damaging Het
Gcnt1 A T 19: 17,330,073 M96K probably benign Het
Ggta1 T C 2: 35,402,560 D245G probably damaging Het
Gm15448 A T 7: 3,825,189 S40T Het
Kcnj14 C G 7: 45,819,388 R231P probably damaging Het
Lamc2 A T 1: 153,144,653 C382* probably null Het
Marveld3 T C 8: 109,961,977 E44G possibly damaging Het
Mettl17 T C 14: 51,891,391 F373L possibly damaging Het
Morc3 T A 16: 93,860,510 L374Q probably damaging Het
Muc16 C T 9: 18,637,298 D5900N probably benign Het
Myo15 A G 11: 60,477,262 N283D probably benign Het
Ncapg2 T G 12: 116,415,478 D197E possibly damaging Het
Nipbl T C 15: 8,303,420 T2240A probably benign Het
Nrip1 A C 16: 76,291,348 V1107G possibly damaging Het
Olfr1275 C A 2: 111,231,489 M101I probably benign Het
Olfr525 T C 7: 140,322,734 F12L probably damaging Het
Olfr984 G A 9: 40,101,340 T50I probably benign Het
Pcdhb11 T A 18: 37,422,496 I293K probably damaging Het
Pcsk5 G T 19: 17,454,774 H1492Q probably benign Het
Pdcd4 T A 19: 53,910,974 Y131* probably null Het
Pdf T A 8: 107,047,164 M216L probably damaging Het
Plch1 T C 3: 63,870,685 H17R possibly damaging Het
Prkdc T G 16: 15,808,204 S3365A probably benign Het
Rab3c T C 13: 110,260,601 T44A probably damaging Het
Rad17 T C 13: 100,629,490 T377A probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf215 T G 11: 4,135,959 probably null Het
Sec31b G A 19: 44,519,181 T808I probably benign Het
Selenbp1 A T 3: 94,937,290 D86V probably damaging Het
Smurf2 G T 11: 106,852,496 Y241* probably null Het
Spint1 T C 2: 119,248,805 V456A possibly damaging Het
Stx5a A T 19: 8,748,560 I175F probably damaging Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tfb1m T C 17: 3,519,652 E313G probably benign Het
Theg G T 10: 79,583,747 N240K possibly damaging Het
Thrb A G 14: 17,963,082 D15G probably benign Het
Tln2 T C 9: 67,258,273 K1045R probably damaging Het
Trabd T C 15: 89,084,949 I192T probably damaging Het
Try5 T A 6: 41,311,703 D194V probably damaging Het
Ttc21a A G 9: 119,967,305 N1263S probably benign Het
Ttll13 T C 7: 80,253,175 I197T probably damaging Het
Virma T C 4: 11,540,643 probably null Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCTTTCCTTGTTGAACAAAACTG -3'
(R):5'- CCTGAAACACTGATATTGGTAGC -3'

Sequencing Primer
(F):5'- TCCTTGTTGAACAAAACTGAAAATAC -3'
(R):5'- ACTTTCAGACCATGACTTTAAAGTG -3'
Posted On2021-03-08