Mutagenetix > Incidental Mutations

Incidental Mutation 'R0105:Il1rl1'

66323

Institutional Source

Beutler Lab

Gene Symbol

Il1rl1

Ensembl Gene

ENSMUSG00000026069

Gene Name

interleukin 1 receptor-like 1

Synonyms

T1 gene, St2-rs1, ST2, T1, T1/ST2, Ly84, Fit-1, DER4, St2, ST2L

MMRRC Submission

038391-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0105 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

40429570-40465415 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

CTTGTTGTTGTTGTTGTTG to CTTGTTGTTGTTGTTGTTGTTG at 40442574 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053043] [ENSMUST00000097772] [ENSMUST00000173514] [ENSMUST00000173881] [ENSMUST00000174335]

Predicted Effect

probably benign
Transcript: ENSMUST00000053043

SMART Domains

Protein: ENSMUSP00000054914
Gene: ENSMUSG00000026069

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IGc2	33	100	7.35e-11	SMART
IGc2	130	194	8.85e-5	SMART
IG_like	225	326	2.66e1	SMART
transmembrane domain	333	355	N/A	INTRINSIC
TIR	381	543	4.23e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097772

SMART Domains

Protein: ENSMUSP00000095379
Gene: ENSMUSG00000026069

Domain	Start	End	E-Value	Type
IGc2	33	100	7.35e-11	SMART
IGc2	130	194	8.85e-5	SMART
IG_like	225	326	2.66e1	SMART
transmembrane domain	333	355	N/A	INTRINSIC
TIR	381	543	4.23e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173514

SMART Domains

Protein: ENSMUSP00000133784
Gene: ENSMUSG00000026069

Domain	Start	End	E-Value	Type
IGc2	33	100	7.35e-11	SMART
IGc2	130	194	8.85e-5	SMART
IG_like	225	326	2.66e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173881

SMART Domains

Protein: ENSMUSP00000134225
Gene: ENSMUSG00000026069

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
PDB:4KC3\|B	27	65	4e-16	PDB
Blast:IGc2	33	65	2e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000174335

SMART Domains

Protein: ENSMUSP00000134351
Gene: ENSMUSG00000026069

Domain	Start	End	E-Value	Type
IGc2	33	100	7.35e-11	SMART
IGc2	130	194	8.85e-5	SMART
IG_like	225	326	2.66e1	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an abnormal Th2 type inflammatory response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,187,392	V698D	probably benign	Het
5530400C23Rik	G	A	6: 133,294,314	R107K	probably benign	Het
A530053G22Rik	T	C	6: 60,402,152		noncoding transcript	Het
Adcy9	A	G	16: 4,288,388	V954A	probably damaging	Het
Aldh8a1	T	A	10: 21,395,539	M388K	probably damaging	Het
Ankhd1	A	G	18: 36,646,766	I1720M	probably damaging	Het
Atp6v0a4	T	C	6: 38,053,129		probably benign	Het
C1qtnf4	T	A	2: 90,890,363	*327R	probably null	Het
C1s1	T	C	6: 124,541,318		probably benign	Het
Cdsn	A	C	17: 35,556,138	R521S	possibly damaging	Het
Cgnl1	T	C	9: 71,656,102	M848V	probably benign	Het
Cog3	A	G	14: 75,722,140	S591P	probably damaging	Het
Col6a3	A	G	1: 90,798,161	V1375A	possibly damaging	Het
Cr1l	A	G	1: 195,112,412		probably benign	Het
Crmp1	T	A	5: 37,284,135	D520E	probably damaging	Het
Ctdspl2	T	A	2: 121,977,320		probably benign	Het
Dnah6	C	T	6: 73,155,279	A1147T	probably damaging	Het
Dsg2	T	C	18: 20,602,054	S1030P	probably benign	Het
Elavl3	C	A	9: 22,036,833	V12F	possibly damaging	Het
Fam20b	T	C	1: 156,690,570	E218G	probably damaging	Het
Fam227a	T	C	15: 79,620,832	D466G	possibly damaging	Het
Fto	G	A	8: 91,522,802	E421K	probably damaging	Het
Gab2	T	C	7: 97,299,072	Y290H	probably damaging	Het
Gm973	A	G	1: 59,582,474	Q591R	probably null	Het
Gsdmc2	T	C	15: 63,828,177	T249A	probably benign	Het
Il15ra	T	A	2: 11,730,648		probably null	Het
Il6ra	A	G	3: 89,876,818	I382T	probably damaging	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Krt76	T	C	15: 101,884,912	T564A	unknown	Het
Lhpp	T	C	7: 132,630,525	S57P	probably damaging	Het
Lrrk1	G	T	7: 66,292,341	D716E	probably damaging	Het
Mcm3ap	T	A	10: 76,499,534	D1263E	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mroh7	T	C	4: 106,711,270	T48A	possibly damaging	Het
Nccrp1	T	C	7: 28,547,038	D33G	probably benign	Het
Neurog1	G	T	13: 56,251,237	D232E	probably benign	Het
Olfr1202	T	A	2: 88,817,909	V246D	probably damaging	Het
Olfr1243	T	C	2: 89,528,363	T16A	probably benign	Het
Otog	C	A	7: 46,288,366	T1833K	possibly damaging	Het
Perm1	C	A	4: 156,218,225	H409N	probably benign	Het
Pik3r5	A	T	11: 68,490,511	E174D	probably damaging	Het
Pkhd1	G	A	1: 20,523,732	Q1386*	probably null	Het
Pla2r1	T	C	2: 60,514,981	R344G	possibly damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plekhg4	G	A	8: 105,382,012	V1202M	possibly damaging	Het
Ppil4	A	G	10: 7,798,446	Y118C	probably damaging	Het
Prrc2b	G	T	2: 32,213,311	E934*	probably null	Het
Psmb9	A	G	17: 34,187,275	F12S	probably benign	Het
Ptdss2	T	C	7: 141,152,880	W183R	probably damaging	Het
Ptpn4	C	T	1: 119,687,605		probably null	Het
Reln	G	A	5: 22,048,815	R600W	probably damaging	Het
Scml4	T	A	10: 42,930,599	V161E	probably damaging	Het
Sdcbp2	A	T	2: 151,589,558	T284S	probably benign	Het
Slc22a29	T	C	19: 8,160,627		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Spen	T	C	4: 141,469,810		probably benign	Het
Sumf2	T	A	5: 129,849,894		probably benign	Het
Tbx10	A	G	19: 3,993,121		probably benign	Het
Tex10	C	A	4: 48,468,957	V73F	probably damaging	Het
Tgm5	C	A	2: 121,077,012	G77W	probably damaging	Het
Tnfrsf21	T	A	17: 43,040,191		probably null	Het
Treml2	C	T	17: 48,302,828	T96I	probably damaging	Het
Trim65	T	C	11: 116,126,066	*523W	probably null	Het
Zcchc17	T	A	4: 130,349,306	D28V	probably benign	Het
Zhx2	T	C	15: 57,822,695	F487L	probably damaging	Het
Zkscan6	T	A	11: 65,821,985	L248Q	probably damaging	Het

Other mutations in Il1rl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Il1rl1	APN	1	40446216	missense	possibly damaging	0.75
IGL01413:Il1rl1	APN	1	40446169	missense	possibly damaging	0.85
IGL01939:Il1rl1	APN	1	40462008	missense	possibly damaging	0.80
IGL02121:Il1rl1	APN	1	40442303	splice site	probably benign
IGL02160:Il1rl1	APN	1	40461837	missense	probably benign	0.00
IGL02695:Il1rl1	APN	1	40446558	missense	possibly damaging	0.47
R0007:Il1rl1	UTSW	1	40446171	missense	possibly damaging	0.95
R0200:Il1rl1	UTSW	1	40441303	missense	possibly damaging	0.95
R0363:Il1rl1	UTSW	1	40442574	splice site	probably benign
R0508:Il1rl1	UTSW	1	40451717	missense	possibly damaging	0.87
R0637:Il1rl1	UTSW	1	40442574	splice site	probably benign
R0676:Il1rl1	UTSW	1	40442574	splice site	probably benign
R1371:Il1rl1	UTSW	1	40442713	missense	probably damaging	0.96
R2074:Il1rl1	UTSW	1	40462044	missense	probably damaging	0.99
R2309:Il1rl1	UTSW	1	40442657	missense	possibly damaging	0.46
R2426:Il1rl1	UTSW	1	40446619	missense	probably damaging	1.00
R3983:Il1rl1	UTSW	1	40446663	missense	possibly damaging	0.73
R4601:Il1rl1	UTSW	1	40441300	missense	possibly damaging	0.88
R4707:Il1rl1	UTSW	1	40450188	missense	probably damaging	0.96
R4720:Il1rl1	UTSW	1	40446678	missense	probably benign	0.24
R4784:Il1rl1	UTSW	1	40450188	missense	probably damaging	0.96
R5137:Il1rl1	UTSW	1	40450125	missense	probably benign
R5765:Il1rl1	UTSW	1	40461943	missense	probably benign	0.06
R5953:Il1rl1	UTSW	1	40442673	missense	probably benign	0.05
R6339:Il1rl1	UTSW	1	40461856	missense	possibly damaging	0.88
R7176:Il1rl1	UTSW	1	40446606	missense	probably damaging	1.00
R7677:Il1rl1	UTSW	1	40446704	makesense	probably null
R8129:Il1rl1	UTSW	1	40451827	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19