Incidental Mutation 'R8742:Ceacam13'
ID663283
Institutional Source Beutler Lab
Gene Symbol Ceacam13
Ensembl Gene ENSMUSG00000057195
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 13
Synonyms1600025J19Rik, Ceacam13-C2, Ceacam13-C1, 1600012K03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8742 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18009889-18019221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18010009 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 14 (S14T)
Ref Sequence ENSEMBL: ENSMUSP00000080404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081703] [ENSMUST00000108488]
Predicted Effect probably damaging
Transcript: ENSMUST00000081703
AA Change: S14T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080404
Gene: ENSMUSG00000057195
AA Change: S14T

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108488
AA Change: S14T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104128
Gene: ENSMUSG00000057195
AA Change: S14T

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,182,012 I45V unknown Het
Adgrb3 T C 1: 25,226,754 I893V probably benign Het
Adhfe1 A G 1: 9,560,176 I317V probably benign Het
Adnp2 A G 18: 80,128,341 V951A probably damaging Het
Ankrd35 T A 3: 96,679,186 H59Q probably damaging Het
Atg16l1 C T 1: 87,766,898 T161I probably damaging Het
Axl A G 7: 25,764,436 V591A probably damaging Het
C87414 T A 5: 93,638,076 D115V probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,101,652 F986L probably damaging Het
Cfh G T 1: 140,136,731 T393K probably damaging Het
Clic1 A G 17: 35,055,380 N179S probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dst T A 1: 34,212,344 D2159E probably benign Het
Epn3 T G 11: 94,496,095 T150P probably damaging Het
Fgr T C 4: 132,997,517 Y310H probably damaging Het
Filip1l A G 16: 57,571,230 Y727C probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Gdf10 A T 14: 33,932,469 H311L probably benign Het
Gphn C T 12: 78,612,992 R423C probably damaging Het
Gpr132 T C 12: 112,855,897 probably benign Het
Herc2 C A 7: 56,094,395 T406K probably benign Het
Hpf1 T C 8: 60,893,714 V21A probably benign Het
Ifitm6 A G 7: 141,016,095 I75T probably benign Het
Itgax A T 7: 128,144,623 H852L probably benign Het
Klhl3 T C 13: 58,011,207 Y546C probably damaging Het
Lbr A G 1: 181,817,006 L578P possibly damaging Het
Ltbp1 A G 17: 75,310,222 Y734C probably damaging Het
Mapre2 C A 18: 23,883,631 H281N probably benign Het
Mcm4 T C 16: 15,625,566 D831G possibly damaging Het
Mlf1 G A 3: 67,397,786 A207T probably damaging Het
Mslnl A T 17: 25,745,073 I459F probably damaging Het
Mtnr1a A G 8: 45,087,683 D227G probably benign Het
Ncapg T A 5: 45,693,874 L803Q probably damaging Het
Nr3c2 T G 8: 76,908,581 S104A probably damaging Het
Olfr1302 A G 2: 111,780,565 I82V probably benign Het
Pard3 C T 8: 127,324,111 A218V possibly damaging Het
Poteg A T 8: 27,494,929 N439Y possibly damaging Het
Ret A T 6: 118,178,523 L404Q probably damaging Het
Ripk4 A T 16: 97,755,072 V157D probably damaging Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,914 probably benign Het
Serinc1 A T 10: 57,519,799 N298K probably benign Het
Shb G C 4: 45,458,319 R282G probably benign Het
Skint11 T C 4: 114,194,725 I90T probably damaging Het
Slc36a4 A G 9: 15,720,743 T72A probably damaging Het
Slc38a9 T A 13: 112,729,284 I505K probably damaging Het
Sprr3 C T 3: 92,457,000 R179H possibly damaging Het
Syne1 A T 10: 5,108,661 I7284N probably benign Het
Timeless A T 10: 128,247,238 T648S probably benign Het
Trim44 A G 2: 102,400,176 M170T possibly damaging Het
Trpm7 A G 2: 126,825,549 F815L probably damaging Het
Uimc1 A G 13: 55,093,158 L39S possibly damaging Het
Vmn2r13 T C 5: 109,156,397 T723A probably benign Het
Zp3r A T 1: 130,583,493 C383S probably damaging Het
Other mutations in Ceacam13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Ceacam13 APN 7 18013353 missense possibly damaging 0.59
IGL01617:Ceacam13 APN 7 18011383 missense possibly damaging 0.53
IGL02948:Ceacam13 APN 7 18011063 splice site probably benign
R1508:Ceacam13 UTSW 7 18011071 missense possibly damaging 0.89
R3794:Ceacam13 UTSW 7 18013415 makesense probably null
R4882:Ceacam13 UTSW 7 18013072 missense probably benign 0.20
R6859:Ceacam13 UTSW 7 18013107 missense probably damaging 1.00
R8081:Ceacam13 UTSW 7 18013188 missense probably damaging 1.00
R8745:Ceacam13 UTSW 7 18010009 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGACTGAGACATTATGAGAGC -3'
(R):5'- TTCCTGCTGCAGAGTTCCTG -3'

Sequencing Primer
(F):5'- TTTGTACACAGGAAATGTCCCCAGG -3'
(R):5'- AGAGTTCCTGCCCCTGTCTG -3'
Posted On2021-03-08