Incidental Mutation 'R8742:Nr3c2'
ID663293
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8742 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 76908581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 104 (S104A)
Ref Sequence ENSEMBL: ENSMUSP00000105538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]
Predicted Effect probably damaging
Transcript: ENSMUST00000034031
AA Change: S104A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: S104A

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109911
AA Change: S104A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: S104A

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109912
AA Change: S104A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: S104A

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109913
AA Change: S104A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: S104A

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128862
AA Change: S104A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000143284
Predicted Effect probably damaging
Transcript: ENSMUST00000148106
AA Change: S104A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: S104A

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,182,012 I45V unknown Het
Adgrb3 T C 1: 25,226,754 I893V probably benign Het
Adhfe1 A G 1: 9,560,176 I317V probably benign Het
Adnp2 A G 18: 80,128,341 V951A probably damaging Het
Ankrd35 T A 3: 96,679,186 H59Q probably damaging Het
Atg16l1 C T 1: 87,766,898 T161I probably damaging Het
Axl A G 7: 25,764,436 V591A probably damaging Het
C87414 T A 5: 93,638,076 D115V probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfh A T 1: 140,101,652 F986L probably damaging Het
Cfh G T 1: 140,136,731 T393K probably damaging Het
Clic1 A G 17: 35,055,380 N179S probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dst T A 1: 34,212,344 D2159E probably benign Het
Epn3 T G 11: 94,496,095 T150P probably damaging Het
Fgr T C 4: 132,997,517 Y310H probably damaging Het
Filip1l A G 16: 57,571,230 Y727C probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Gdf10 A T 14: 33,932,469 H311L probably benign Het
Gphn C T 12: 78,612,992 R423C probably damaging Het
Gpr132 T C 12: 112,855,897 probably benign Het
Herc2 C A 7: 56,094,395 T406K probably benign Het
Hpf1 T C 8: 60,893,714 V21A probably benign Het
Ifitm6 A G 7: 141,016,095 I75T probably benign Het
Itgax A T 7: 128,144,623 H852L probably benign Het
Klhl3 T C 13: 58,011,207 Y546C probably damaging Het
Lbr A G 1: 181,817,006 L578P possibly damaging Het
Ltbp1 A G 17: 75,310,222 Y734C probably damaging Het
Mapre2 C A 18: 23,883,631 H281N probably benign Het
Mcm4 T C 16: 15,625,566 D831G possibly damaging Het
Mlf1 G A 3: 67,397,786 A207T probably damaging Het
Mslnl A T 17: 25,745,073 I459F probably damaging Het
Mtnr1a A G 8: 45,087,683 D227G probably benign Het
Ncapg T A 5: 45,693,874 L803Q probably damaging Het
Olfr1302 A G 2: 111,780,565 I82V probably benign Het
Pard3 C T 8: 127,324,111 A218V possibly damaging Het
Poteg A T 8: 27,494,929 N439Y possibly damaging Het
Ret A T 6: 118,178,523 L404Q probably damaging Het
Ripk4 A T 16: 97,755,072 V157D probably damaging Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,914 probably benign Het
Serinc1 A T 10: 57,519,799 N298K probably benign Het
Shb G C 4: 45,458,319 R282G probably benign Het
Skint11 T C 4: 114,194,725 I90T probably damaging Het
Slc36a4 A G 9: 15,720,743 T72A probably damaging Het
Slc38a9 T A 13: 112,729,284 I505K probably damaging Het
Sprr3 C T 3: 92,457,000 R179H possibly damaging Het
Syne1 A T 10: 5,108,661 I7284N probably benign Het
Timeless A T 10: 128,247,238 T648S probably benign Het
Trim44 A G 2: 102,400,176 M170T possibly damaging Het
Trpm7 A G 2: 126,825,549 F815L probably damaging Het
Uimc1 A G 13: 55,093,158 L39S possibly damaging Het
Vmn2r13 T C 5: 109,156,397 T723A probably benign Het
Zp3r A T 1: 130,583,493 C383S probably damaging Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 splice site probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 splice site probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 splice site probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1737:Nr3c2 UTSW 8 76908329 missense probably benign 0.16
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 splice site probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
R8743:Nr3c2 UTSW 8 76909758 missense probably damaging 1.00
R8806:Nr3c2 UTSW 8 77242463 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Z1176:Nr3c2 UTSW 8 76909700 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTCTCTTGGACCTGCAGAGAG -3'
(R):5'- TGAATGACCTCAAAGGCCTG -3'

Sequencing Primer
(F):5'- CTACATGGAGATTGTCAACGTCAGC -3'
(R):5'- TGACCTCAAAGGCCTGCTTATAG -3'
Posted On2021-03-08