Incidental Mutation 'R8742:Filip1l'
ID 663309
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Name filamin A interacting protein 1-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8742 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 57353093-57573126 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57571230 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 727 (Y727C)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159414
AA Change: Y489C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: Y489C

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159816
AA Change: Y727C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: Y727C

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,182,012 I45V unknown Het
Adgrb3 T C 1: 25,226,754 I893V probably benign Het
Adhfe1 A G 1: 9,560,176 I317V probably benign Het
Adnp2 A G 18: 80,128,341 V951A probably damaging Het
Ankrd35 T A 3: 96,679,186 H59Q probably damaging Het
Atg16l1 C T 1: 87,766,898 T161I probably damaging Het
Axl A G 7: 25,764,436 V591A probably damaging Het
C87414 T A 5: 93,638,076 D115V probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfh A T 1: 140,101,652 F986L probably damaging Het
Cfh G T 1: 140,136,731 T393K probably damaging Het
Clic1 A G 17: 35,055,380 N179S probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dst T A 1: 34,212,344 D2159E probably benign Het
Epn3 T G 11: 94,496,095 T150P probably damaging Het
Fgr T C 4: 132,997,517 Y310H probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gdf10 A T 14: 33,932,469 H311L probably benign Het
Gphn C T 12: 78,612,992 R423C probably damaging Het
Gpr132 T C 12: 112,855,897 probably benign Het
Herc2 C A 7: 56,094,395 T406K probably benign Het
Hpf1 T C 8: 60,893,714 V21A probably benign Het
Ifitm6 A G 7: 141,016,095 I75T probably benign Het
Itgax A T 7: 128,144,623 H852L probably benign Het
Klhl3 T C 13: 58,011,207 Y546C probably damaging Het
Lbr A G 1: 181,817,006 L578P possibly damaging Het
Ltbp1 A G 17: 75,310,222 Y734C probably damaging Het
Mapre2 C A 18: 23,883,631 H281N probably benign Het
Mcm4 T C 16: 15,625,566 D831G possibly damaging Het
Mlf1 G A 3: 67,397,786 A207T probably damaging Het
Mslnl A T 17: 25,745,073 I459F probably damaging Het
Mtnr1a A G 8: 45,087,683 D227G probably benign Het
Ncapg T A 5: 45,693,874 L803Q probably damaging Het
Nr3c2 T G 8: 76,908,581 S104A probably damaging Het
Olfr1302 A G 2: 111,780,565 I82V probably benign Het
Pard3 C T 8: 127,324,111 A218V possibly damaging Het
Poteg A T 8: 27,494,929 N439Y possibly damaging Het
Ret A T 6: 118,178,523 L404Q probably damaging Het
Ripk4 A T 16: 97,755,072 V157D probably damaging Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,914 probably benign Het
Serinc1 A T 10: 57,519,799 N298K probably benign Het
Sh3pxd2a G A 19: 47,286,634 S230L probably benign Het
Shb G C 4: 45,458,319 R282G probably benign Het
Skint11 T C 4: 114,194,725 I90T probably damaging Het
Slc36a4 A G 9: 15,720,743 T72A probably damaging Het
Slc38a9 T A 13: 112,729,284 I505K probably damaging Het
Sprr3 C T 3: 92,457,000 R179H possibly damaging Het
Syne1 A T 10: 5,108,661 I7284N probably benign Het
Timeless A T 10: 128,247,238 T648S probably benign Het
Trim44 A G 2: 102,400,176 M170T possibly damaging Het
Trpm7 A G 2: 126,825,549 F815L probably damaging Het
Uimc1 A G 13: 55,093,158 L39S possibly damaging Het
Vmn2r13 T C 5: 109,156,397 T723A probably benign Het
Vps11 A G 9: 44,355,773 probably benign Het
Zp3r A T 1: 130,583,493 C383S probably damaging Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
R9020:Filip1l UTSW 16 57570695 missense probably benign 0.00
R9157:Filip1l UTSW 16 57571617 missense probably benign 0.04
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAGGAGCTGGAACATG -3'
(R):5'- TAGTCTGGTGGCTCACTGTC -3'

Sequencing Primer
(F):5'- CATGCCAAGATGGAGCTTGC -3'
(R):5'- AATACTTGCGGGTCAGAGATTC -3'
Posted On 2021-03-08