Mutagenetix > Incidental Mutations

Incidental Mutation 'R8742:Filip1l'

663309

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8742 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57571230 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 727 (Y727C)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159414
AA Change: Y489C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: Y489C

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159816
AA Change: Y727C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: Y727C

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.0%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430419D17Rik	A	G	7: 131,182,012	I45V	unknown	Het
Adgrb3	T	C	1: 25,226,754	I893V	probably benign	Het
Adhfe1	A	G	1: 9,560,176	I317V	probably benign	Het
Adnp2	A	G	18: 80,128,341	V951A	probably damaging	Het
Ankrd35	T	A	3: 96,679,186	H59Q	probably damaging	Het
Atg16l1	C	T	1: 87,766,898	T161I	probably damaging	Het
Axl	A	G	7: 25,764,436	V591A	probably damaging	Het
C87414	T	A	5: 93,638,076	D115V	probably damaging	Het
Cdc40	C	T	10: 40,841,484	D404N	probably damaging	Het
Ceacam13	T	A	7: 18,010,009	S14T	probably damaging	Het
Cfh	A	T	1: 140,101,652	F986L	probably damaging	Het
Cfh	G	T	1: 140,136,731	T393K	probably damaging	Het
Clic1	A	G	17: 35,055,380	N179S	probably benign	Het
Col6a3	C	G	1: 90,767,606		probably benign	Het
Dlat	G	T	9: 50,649,667	A360E	probably damaging	Het
Dst	T	A	1: 34,212,344	D2159E	probably benign	Het
Epn3	T	G	11: 94,496,095	T150P	probably damaging	Het
Fgr	T	C	4: 132,997,517	Y310H	probably damaging	Het
Fis1	G	T	5: 136,953,511		probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gdf10	A	T	14: 33,932,469	H311L	probably benign	Het
Gphn	C	T	12: 78,612,992	R423C	probably damaging	Het
Gpr132	T	C	12: 112,855,897		probably benign	Het
Herc2	C	A	7: 56,094,395	T406K	probably benign	Het
Hpf1	T	C	8: 60,893,714	V21A	probably benign	Het
Ifitm6	A	G	7: 141,016,095	I75T	probably benign	Het
Itgax	A	T	7: 128,144,623	H852L	probably benign	Het
Klhl3	T	C	13: 58,011,207	Y546C	probably damaging	Het
Lbr	A	G	1: 181,817,006	L578P	possibly damaging	Het
Ltbp1	A	G	17: 75,310,222	Y734C	probably damaging	Het
Mapre2	C	A	18: 23,883,631	H281N	probably benign	Het
Mcm4	T	C	16: 15,625,566	D831G	possibly damaging	Het
Mlf1	G	A	3: 67,397,786	A207T	probably damaging	Het
Mslnl	A	T	17: 25,745,073	I459F	probably damaging	Het
Mtnr1a	A	G	8: 45,087,683	D227G	probably benign	Het
Ncapg	T	A	5: 45,693,874	L803Q	probably damaging	Het
Nr3c2	T	G	8: 76,908,581	S104A	probably damaging	Het
Olfr1302	A	G	2: 111,780,565	I82V	probably benign	Het
Pard3	C	T	8: 127,324,111	A218V	possibly damaging	Het
Poteg	A	T	8: 27,494,929	N439Y	possibly damaging	Het
Ret	A	T	6: 118,178,523	L404Q	probably damaging	Het
Ripk4	A	T	16: 97,755,072	V157D	probably damaging	Het
Rsf1	CGGCGGCGGCGGCGGCGGCGGC	CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC	7: 97,579,914		probably benign	Het
Serinc1	A	T	10: 57,519,799	N298K	probably benign	Het
Sh3pxd2a	G	A	19: 47,286,634	S230L	probably benign	Het
Shb	G	C	4: 45,458,319	R282G	probably benign	Het
Skint11	T	C	4: 114,194,725	I90T	probably damaging	Het
Slc36a4	A	G	9: 15,720,743	T72A	probably damaging	Het
Slc38a9	T	A	13: 112,729,284	I505K	probably damaging	Het
Sprr3	C	T	3: 92,457,000	R179H	possibly damaging	Het
Syne1	A	T	10: 5,108,661	I7284N	probably benign	Het
Timeless	A	T	10: 128,247,238	T648S	probably benign	Het
Trim44	A	G	2: 102,400,176	M170T	possibly damaging	Het
Trpm7	A	G	2: 126,825,549	F815L	probably damaging	Het
Uimc1	A	G	13: 55,093,158	L39S	possibly damaging	Het
Vmn2r13	T	C	5: 109,156,397	T723A	probably benign	Het
Vps11	A	G	9: 44,355,773		probably benign	Het
Zp3r	A	T	1: 130,583,493	C383S	probably damaging	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R9020:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTCAGGAGCTGGAACATG -3'
(R):5'- TAGTCTGGTGGCTCACTGTC -3'

Sequencing Primer
(F):5'- CATGCCAAGATGGAGCTTGC -3'
(R):5'- AATACTTGCGGGTCAGAGATTC -3'

Posted On

2021-03-08