Incidental Mutation 'R8743:Fam193a'
ID 663336
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Name family with sequence homology 193, member A
Synonyms
MMRRC Submission 068588-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R8743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 34527277-34643800 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 34577501 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180376] [ENSMUST00000180376]
AlphaFold Q8CGI1
Predicted Effect probably null
Transcript: ENSMUST00000180376
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180376
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 25,276,264 (GRCm39) C468S probably damaging Het
Adamts7 G A 9: 90,077,296 (GRCm39) R1321H probably damaging Het
Adra2c T C 5: 35,437,792 (GRCm39) V188A possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Ap1g1 A G 8: 110,564,423 (GRCm39) N323D probably damaging Het
Arhgap15 A T 2: 43,638,876 (GRCm39) probably benign Het
Arhgef33 T C 17: 80,667,882 (GRCm39) probably null Het
Armc1 C T 3: 19,211,700 (GRCm39) C40Y probably benign Het
Arsk C A 13: 76,214,928 (GRCm39) V309F probably damaging Het
Atp4b A T 8: 13,443,489 (GRCm39) M63K probably damaging Het
Cacna1s T C 1: 136,033,286 (GRCm39) L1237P probably damaging Het
Ccnt2 A G 1: 127,702,020 (GRCm39) E19G probably damaging Het
Ccr2 A C 9: 123,906,131 (GRCm39) Y137S probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Cfh A T 1: 140,046,323 (GRCm39) probably null Het
Chd5 T A 4: 152,450,862 (GRCm39) V662E probably benign Het
Cnga4 A G 7: 105,057,220 (GRCm39) D544G probably benign Het
Col6a3 C G 1: 90,695,328 (GRCm39) probably benign Het
Coro6 T A 11: 77,357,265 (GRCm39) I158N probably damaging Het
Cpa1 A G 6: 30,642,992 (GRCm39) S307G probably damaging Het
Depdc5 T A 5: 33,081,587 (GRCm39) M583K probably benign Het
Dock2 G T 11: 34,223,252 (GRCm39) S1170* probably null Het
Dusp16 A T 6: 134,694,933 (GRCm39) S633T probably benign Het
Esco1 T C 18: 10,572,123 (GRCm39) E739G probably damaging Het
Fat4 G A 3: 38,942,592 (GRCm39) S495N probably benign Het
Galnt10 A G 11: 57,675,409 (GRCm39) Y556C probably damaging Het
Garin5b T A 7: 4,760,814 (GRCm39) T633S Het
Gc A T 5: 89,591,311 (GRCm39) D142E probably benign Het
Gda A T 19: 21,377,952 (GRCm39) F369Y probably damaging Het
Glce A T 9: 61,968,103 (GRCm39) S349R probably benign Het
Glp2r A G 11: 67,612,901 (GRCm39) L351P probably damaging Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Gxylt2 A T 6: 100,764,284 (GRCm39) Y323F probably benign Het
Hmmr T C 11: 40,598,858 (GRCm39) N589D probably damaging Het
Hsd17b3 A C 13: 64,210,712 (GRCm39) D214E probably benign Het
Kat6a A G 8: 23,429,022 (GRCm39) D1459G possibly damaging Het
Lad1 G A 1: 135,758,933 (GRCm39) R465H probably benign Het
Lcmt1 T A 7: 122,999,691 (GRCm39) D46E probably damaging Het
Map4k1 G A 7: 28,686,542 (GRCm39) D155N probably damaging Het
Mylk G T 16: 34,741,427 (GRCm39) R796L probably benign Het
Nat8l T A 5: 34,154,510 (GRCm39) L108Q probably damaging Het
Nlrp5 T C 7: 23,118,172 (GRCm39) V632A probably benign Het
Nr3c2 A G 8: 77,636,387 (GRCm39) E496G probably damaging Het
Nucb2 A G 7: 116,128,065 (GRCm39) D258G probably damaging Het
Or8b12 G T 9: 37,658,174 (GRCm39) C248F probably benign Het
Or8b56 A T 9: 38,738,995 (GRCm39) I3F probably benign Het
Papln A G 12: 83,829,764 (GRCm39) K962E probably damaging Het
Pcdha8 T A 18: 37,127,372 (GRCm39) M618K probably benign Het
Pclo A G 5: 14,764,580 (GRCm39) D1066G Het
Phip A T 9: 82,809,140 (GRCm39) M446K probably benign Het
Pkn3 A G 2: 29,973,318 (GRCm39) K380R probably benign Het
Potefam1 T C 2: 111,000,017 (GRCm39) T198A unknown Het
Ppa1 C A 10: 61,496,758 (GRCm39) A82E possibly damaging Het
Prune2 A C 19: 17,096,920 (GRCm39) D808A probably benign Het
Psme4 T G 11: 30,828,467 (GRCm39) L1829R probably damaging Het
Rtp4 A C 16: 23,431,866 (GRCm39) K133Q possibly damaging Het
Scaf11 C T 15: 96,313,669 (GRCm39) A1371T probably benign Het
Serpinb9g A T 13: 33,678,931 (GRCm39) H267L probably benign Het
Slc47a2 T G 11: 61,233,588 (GRCm39) D6A probably benign Het
Slco1a4 A T 6: 141,765,255 (GRCm39) V329D possibly damaging Het
Smg6 T C 11: 74,820,859 (GRCm39) S377P probably benign Het
Spata31g1 A G 4: 42,971,030 (GRCm39) H121R probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Taar2 A T 10: 23,817,369 (GRCm39) Y303F probably damaging Het
Tgm6 A G 2: 129,985,418 (GRCm39) D407G probably damaging Het
Twf2 A G 9: 106,090,010 (GRCm39) E153G possibly damaging Het
Upb1 A G 10: 75,275,710 (GRCm39) Y365C probably damaging Het
Vmn2r4 A T 3: 64,317,247 (GRCm39) S164T possibly damaging Het
Wtip C T 7: 33,824,979 (GRCm39) G202R possibly damaging Het
Zfhx4 G A 3: 5,309,084 (GRCm39) C770Y probably damaging Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34,588,537 (GRCm39) missense probably damaging 0.99
IGL02111:Fam193a APN 5 34,568,001 (GRCm39) missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34,602,081 (GRCm39) missense probably benign 0.12
IGL02218:Fam193a APN 5 34,600,932 (GRCm39) missense possibly damaging 0.68
BB010:Fam193a UTSW 5 34,623,539 (GRCm39) missense possibly damaging 0.53
BB020:Fam193a UTSW 5 34,623,539 (GRCm39) missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34,597,807 (GRCm39) missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34,597,879 (GRCm39) missense probably damaging 0.97
R0172:Fam193a UTSW 5 34,622,957 (GRCm39) missense probably damaging 0.97
R0413:Fam193a UTSW 5 34,623,552 (GRCm39) missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34,583,735 (GRCm39) missense probably damaging 1.00
R0735:Fam193a UTSW 5 34,596,722 (GRCm39) missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34,600,685 (GRCm39) missense probably damaging 0.99
R0904:Fam193a UTSW 5 34,619,487 (GRCm39) missense probably damaging 1.00
R1756:Fam193a UTSW 5 34,623,636 (GRCm39) missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34,593,841 (GRCm39) missense probably damaging 0.99
R1766:Fam193a UTSW 5 34,619,475 (GRCm39) missense probably damaging 0.99
R1845:Fam193a UTSW 5 34,600,716 (GRCm39) missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34,619,494 (GRCm39) missense probably benign 0.19
R2483:Fam193a UTSW 5 34,623,102 (GRCm39) missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34,623,016 (GRCm39) missense probably benign 0.33
R4523:Fam193a UTSW 5 34,600,715 (GRCm39) missense probably benign 0.07
R4723:Fam193a UTSW 5 34,578,130 (GRCm39) missense probably benign 0.04
R4823:Fam193a UTSW 5 34,616,372 (GRCm39) missense probably damaging 1.00
R4826:Fam193a UTSW 5 34,593,875 (GRCm39) missense probably damaging 1.00
R4863:Fam193a UTSW 5 34,623,549 (GRCm39) missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34,622,915 (GRCm39) splice site probably null
R5364:Fam193a UTSW 5 34,623,597 (GRCm39) missense probably benign 0.01
R5564:Fam193a UTSW 5 34,578,199 (GRCm39) missense probably damaging 0.98
R5580:Fam193a UTSW 5 34,578,132 (GRCm39) missense probably benign 0.33
R5784:Fam193a UTSW 5 34,623,567 (GRCm39) missense probably damaging 0.99
R5933:Fam193a UTSW 5 34,623,024 (GRCm39) missense probably damaging 0.98
R5949:Fam193a UTSW 5 34,597,816 (GRCm39) missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34,616,374 (GRCm39) missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34,600,884 (GRCm39) splice site probably null
R7095:Fam193a UTSW 5 34,615,378 (GRCm39) missense probably damaging 0.99
R7109:Fam193a UTSW 5 34,623,165 (GRCm39) missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34,643,074 (GRCm39) missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34,622,979 (GRCm39) missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34,621,460 (GRCm39) missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34,578,132 (GRCm39) missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34,588,526 (GRCm39) missense probably damaging 0.99
R7768:Fam193a UTSW 5 34,623,135 (GRCm39) missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34,588,524 (GRCm39) missense probably damaging 0.99
R7818:Fam193a UTSW 5 34,622,997 (GRCm39) missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34,568,161 (GRCm39) missense probably benign 0.01
R7853:Fam193a UTSW 5 34,597,473 (GRCm39) missense probably benign 0.12
R7894:Fam193a UTSW 5 34,597,877 (GRCm39) missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34,623,539 (GRCm39) missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34,619,430 (GRCm39) missense probably damaging 1.00
R8191:Fam193a UTSW 5 34,597,917 (GRCm39) missense probably damaging 0.96
R8281:Fam193a UTSW 5 34,600,780 (GRCm39) missense unknown
R8554:Fam193a UTSW 5 34,633,115 (GRCm39) missense probably benign 0.05
R8821:Fam193a UTSW 5 34,616,374 (GRCm39) missense probably benign 0.01
R8831:Fam193a UTSW 5 34,616,374 (GRCm39) missense probably benign 0.01
R8896:Fam193a UTSW 5 34,583,828 (GRCm39) missense probably benign 0.03
R8943:Fam193a UTSW 5 34,597,796 (GRCm39) missense probably benign 0.01
R9026:Fam193a UTSW 5 34,616,536 (GRCm39) missense possibly damaging 0.91
R9182:Fam193a UTSW 5 34,623,361 (GRCm39) missense possibly damaging 0.72
R9210:Fam193a UTSW 5 34,597,481 (GRCm39) missense probably benign 0.01
R9212:Fam193a UTSW 5 34,597,481 (GRCm39) missense probably benign 0.01
R9291:Fam193a UTSW 5 34,593,835 (GRCm39) missense probably damaging 1.00
R9515:Fam193a UTSW 5 34,615,371 (GRCm39) missense possibly damaging 0.86
Z1088:Fam193a UTSW 5 34,578,239 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACTCTTGTCACCTGATAGTCCC -3'
(R):5'- GCCCGACTTACTAGTGTTTAGTC -3'

Sequencing Primer
(F):5'- CCTCCTGAGTGCTGAGATAAAAGTC -3'
(R):5'- ACTAGTGTTTAGTCTCTTAAGGGC -3'
Posted On 2021-03-08