Incidental Mutation 'R8743:Cpa1'
ID 663339
Institutional Source Beutler Lab
Gene Symbol Cpa1
Ensembl Gene ENSMUSG00000054446
Gene Name carboxypeptidase A1, pancreatic
Synonyms 0910001L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 30639218-30645363 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30642993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 307 (S307G)
Ref Sequence ENSEMBL: ENSMUSP00000031806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031806]
AlphaFold Q7TPZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000031806
AA Change: S307G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031806
Gene: ENSMUSG00000054446
AA Change: S307G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 1.6e-24 PFAM
Zn_pept 122 402 1.09e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase A, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme. This gene is expressed in pancreas, the encoded protein is a major component of digestive enzymes secreted by pancreas and plays an important role in the process of digestion. This gene is located in a cluster of related carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adam5 A T 8: 24,786,248 C468S probably damaging Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Dusp16 A T 6: 134,717,970 S633T probably benign Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glce A T 9: 62,060,821 S349R probably benign Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Psme4 T G 11: 30,878,467 L1829R probably damaging Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Slco1a4 A T 6: 141,819,529 V329D possibly damaging Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Cpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cpa1 APN 6 30642969 missense probably benign 0.05
IGL01288:Cpa1 APN 6 30640583 missense probably damaging 1.00
IGL01402:Cpa1 APN 6 30645276 missense possibly damaging 0.83
IGL01504:Cpa1 APN 6 30640721 missense probably benign 0.00
IGL01980:Cpa1 APN 6 30641582 missense possibly damaging 0.78
IGL02885:Cpa1 APN 6 30645170 missense probably damaging 1.00
P0026:Cpa1 UTSW 6 30640906 missense probably damaging 0.96
PIT4544001:Cpa1 UTSW 6 30641858 missense probably benign 0.00
R0398:Cpa1 UTSW 6 30645251 missense probably benign 0.00
R0403:Cpa1 UTSW 6 30641857 missense probably benign 0.15
R1117:Cpa1 UTSW 6 30645261 missense probably benign 0.16
R1548:Cpa1 UTSW 6 30642335 missense probably damaging 1.00
R1631:Cpa1 UTSW 6 30640924 missense probably damaging 1.00
R1780:Cpa1 UTSW 6 30643008 missense probably damaging 1.00
R2202:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2203:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2204:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2205:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R4838:Cpa1 UTSW 6 30639516 missense possibly damaging 0.80
R5497:Cpa1 UTSW 6 30640730 missense probably benign 0.42
R6306:Cpa1 UTSW 6 30640954 missense probably damaging 1.00
R7062:Cpa1 UTSW 6 30640677 missense probably benign 0.03
R7085:Cpa1 UTSW 6 30643620 missense probably benign 0.10
R7564:Cpa1 UTSW 6 30641768 missense probably damaging 0.97
R8785:Cpa1 UTSW 6 30645252 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGGAAGCCATGGACATCTTG -3'
(R):5'- GTTGACACAAATCACCCTGC -3'

Sequencing Primer
(F):5'- AGCCATGGACATCTTGGGTTAAG -3'
(R):5'- GGCCCACTGGTAGATTCTTAGC -3'
Posted On 2021-03-08