Incidental Mutation 'R8743:Dusp16'
ID 663341
Institutional Source Beutler Lab
Gene Symbol Dusp16
Ensembl Gene ENSMUSG00000030203
Gene Name dual specificity phosphatase 16
Synonyms 3830417M17Rik, D6Ertd213e, MKP7, MKP-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock # R8743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 134715468-134792625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 134717970 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 633 (S633T)
Ref Sequence ENSEMBL: ENSMUSP00000098419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100857] [ENSMUST00000129433] [ENSMUST00000204083]
AlphaFold Q6PCP3
Predicted Effect probably benign
Transcript: ENSMUST00000100857
AA Change: S633T

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098419
Gene: ENSMUSG00000030203
AA Change: S633T

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
DSPc 158 297 1.66e-68 SMART
Blast:DSPc 576 621 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129433
AA Change: S311T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000115925
Gene: ENSMUSG00000030203
AA Change: S311T

DomainStartEndE-ValueType
Blast:RHOD 1 67 8e-41 BLAST
PDB:2VSW|B 1 83 1e-52 PDB
DSPc 91 232 3.73e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148926
Predicted Effect probably benign
Transcript: ENSMUST00000204083
SMART Domains Protein: ENSMUSP00000144834
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 124 1.5e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality and decreased birth weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adam5 A T 8: 24,786,248 C468S probably damaging Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Cpa1 A G 6: 30,642,993 S307G probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glce A T 9: 62,060,821 S349R probably benign Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Psme4 T G 11: 30,878,467 L1829R probably damaging Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Slco1a4 A T 6: 141,819,529 V329D possibly damaging Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Dusp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Dusp16 APN 6 134725949 missense probably benign 0.13
IGL01305:Dusp16 APN 6 134718861 missense probably benign 0.03
IGL01331:Dusp16 APN 6 134718104 missense possibly damaging 0.53
IGL02535:Dusp16 APN 6 134718827 missense probably benign
IGL02606:Dusp16 APN 6 134761036 missense probably damaging 0.96
IGL02696:Dusp16 APN 6 134718435 missense probably damaging 0.99
ANU22:Dusp16 UTSW 6 134718861 missense probably benign 0.03
PIT4469001:Dusp16 UTSW 6 134761152 unclassified probably benign
PIT4504001:Dusp16 UTSW 6 134739883 missense possibly damaging 0.90
R0492:Dusp16 UTSW 6 134718402 missense probably benign
R0578:Dusp16 UTSW 6 134718321 missense probably damaging 1.00
R1630:Dusp16 UTSW 6 134720561 missense probably damaging 1.00
R1962:Dusp16 UTSW 6 134718136 nonsense probably null
R2004:Dusp16 UTSW 6 134718839 missense probably benign
R3690:Dusp16 UTSW 6 134761119 unclassified probably benign
R3730:Dusp16 UTSW 6 134718861 missense probably benign
R5778:Dusp16 UTSW 6 134718314 missense probably benign 0.01
R6267:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6296:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6860:Dusp16 UTSW 6 134725879 nonsense probably null
R7248:Dusp16 UTSW 6 134718977 missense probably benign 0.01
R7645:Dusp16 UTSW 6 134725925 missense probably damaging 0.97
R8108:Dusp16 UTSW 6 134739873 missense probably benign
R8824:Dusp16 UTSW 6 134739769 missense probably benign
R8934:Dusp16 UTSW 6 134741676 intron probably benign
R9328:Dusp16 UTSW 6 134739939 missense probably damaging 1.00
R9364:Dusp16 UTSW 6 134719019 missense probably damaging 1.00
R9430:Dusp16 UTSW 6 134760866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGTTGATCCATCTGTTGC -3'
(R):5'- TACTCTGCCTACAGCTGTGG -3'

Sequencing Primer
(F):5'- ATCTGTTGCTTTTATACCGTAGC -3'
(R):5'- GCCAGCTGCCCACTTGC -3'
Posted On 2021-03-08