Incidental Mutation 'R8743:Slco1a4'
ID 663342
Institutional Source Beutler Lab
Gene Symbol Slco1a4
Ensembl Gene ENSMUSG00000030237
Gene Name solute carrier organic anion transporter family, member 1a4
Synonyms Oatp2, Oatp1a4, Slc21a5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 141805440-141856199 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141819529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 329 (V329D)
Ref Sequence ENSEMBL: ENSMUSP00000130746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032364] [ENSMUST00000165990]
AlphaFold Q9EP96
Predicted Effect possibly damaging
Transcript: ENSMUST00000032364
AA Change: V329D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032364
Gene: ENSMUSG00000030237
AA Change: V329D

DomainStartEndE-ValueType
Pfam:OATP 19 598 3.2e-196 PFAM
Pfam:MFS_1 22 421 9.2e-27 PFAM
Pfam:Kazal_2 445 486 5e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165990
AA Change: V329D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130746
Gene: ENSMUSG00000030237
AA Change: V329D

DomainStartEndE-ValueType
Pfam:OATP 21 597 3.2e-164 PFAM
Pfam:MFS_1 22 421 7.2e-27 PFAM
Pfam:Kazal_2 445 486 6.8e-11 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adam5 A T 8: 24,786,248 C468S probably damaging Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Cpa1 A G 6: 30,642,993 S307G probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Dusp16 A T 6: 134,717,970 S633T probably benign Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glce A T 9: 62,060,821 S349R probably benign Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Psme4 T G 11: 30,878,467 L1829R probably damaging Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Slco1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Slco1a4 APN 6 141807182 critical splice acceptor site probably null
IGL01573:Slco1a4 APN 6 141812851 splice site probably benign
IGL01735:Slco1a4 APN 6 141817751 missense probably benign 0.00
IGL03115:Slco1a4 APN 6 141819603 missense probably benign 0.05
IGL03115:Slco1a4 APN 6 141817859 missense probably damaging 1.00
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0305:Slco1a4 UTSW 6 141817753 missense possibly damaging 0.47
R0511:Slco1a4 UTSW 6 141830860 splice site probably benign
R0660:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R0664:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R1589:Slco1a4 UTSW 6 141845447 missense probably benign
R1606:Slco1a4 UTSW 6 141839611 missense probably damaging 1.00
R1665:Slco1a4 UTSW 6 141839577 missense possibly damaging 0.79
R1742:Slco1a4 UTSW 6 141825045 missense probably benign 0.07
R1763:Slco1a4 UTSW 6 141812731 missense probably benign 0.26
R1893:Slco1a4 UTSW 6 141834616 splice site probably null
R1908:Slco1a4 UTSW 6 141815447 critical splice donor site probably null
R1944:Slco1a4 UTSW 6 141839550 missense probably benign 0.00
R2144:Slco1a4 UTSW 6 141809378 missense probably damaging 1.00
R2276:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.49
R2340:Slco1a4 UTSW 6 141841377 missense probably benign 0.00
R3017:Slco1a4 UTSW 6 141812670 splice site probably null
R3769:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R4577:Slco1a4 UTSW 6 141819540 missense probably damaging 0.97
R4650:Slco1a4 UTSW 6 141812698 missense possibly damaging 0.94
R4801:Slco1a4 UTSW 6 141845497 start gained probably benign
R4802:Slco1a4 UTSW 6 141845497 start gained probably benign
R4896:Slco1a4 UTSW 6 141815505 missense possibly damaging 0.91
R5126:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.94
R5183:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R5399:Slco1a4 UTSW 6 141830707 missense probably damaging 0.98
R5645:Slco1a4 UTSW 6 141834659 missense possibly damaging 0.95
R5650:Slco1a4 UTSW 6 141809394 missense possibly damaging 0.69
R5832:Slco1a4 UTSW 6 141819544 missense probably benign 0.00
R6180:Slco1a4 UTSW 6 141817820 missense possibly damaging 0.95
R6415:Slco1a4 UTSW 6 141834689 nonsense probably null
R6992:Slco1a4 UTSW 6 141819604 missense probably benign 0.05
R7024:Slco1a4 UTSW 6 141834708 missense probably benign 0.00
R7696:Slco1a4 UTSW 6 141810511 nonsense probably null
R7751:Slco1a4 UTSW 6 141834687 missense possibly damaging 0.47
R9173:Slco1a4 UTSW 6 141815573 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATCATGCACTTGAGGATAGATACTG -3'
(R):5'- TTGTCACAGCACAGAATCCATG -3'

Sequencing Primer
(F):5'- TTGGCCCATATGAAGTGGCAC -3'
(R):5'- CAGCACAGAATCCATGAGATTTTAGG -3'
Posted On 2021-03-08