Incidental Mutation 'R8743:Glce'
ID663357
Institutional Source Beutler Lab
Gene Symbol Glce
Ensembl Gene ENSMUSG00000032252
Gene Nameglucuronyl C5-epimerase
Synonyms1110017N23Rik, C130034A12Rik, Hsepi, heparan sulfate-glucuronic acid C5-epimerase
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8743 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62057248-62122655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62060821 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 349 (S349R)
Ref Sequence ENSEMBL: ENSMUSP00000034785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034785] [ENSMUST00000185675]
Predicted Effect probably benign
Transcript: ENSMUST00000034785
AA Change: S349R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034785
Gene: ENSMUSG00000032252
AA Change: S349R

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185675
AA Change: S349R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139949
Gene: ENSMUSG00000032252
AA Change: S349R

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 6.1e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice die immediately after birth showing severe developmental defects including renal agenesis, lung abnormalities, and skeletal malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adam5 A T 8: 24,786,248 C468S probably damaging Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Cpa1 A G 6: 30,642,993 S307G probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Dusp16 A T 6: 134,717,970 S633T probably benign Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Psme4 T G 11: 30,878,467 L1829R probably damaging Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Slco1a4 A T 6: 141,819,529 V329D possibly damaging Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Glce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Glce APN 9 62060483 missense probably damaging 1.00
IGL02005:Glce APN 9 62060577 missense probably damaging 1.00
IGL02093:Glce APN 9 62070539 missense probably damaging 1.00
IGL02102:Glce APN 9 62070601 utr 5 prime probably benign
IGL02243:Glce APN 9 62070140 missense probably damaging 1.00
IGL03099:Glce APN 9 62060062 missense probably benign 0.18
R0004:Glce UTSW 9 62068579 missense probably damaging 1.00
R0626:Glce UTSW 9 62061000 missense probably benign
R1204:Glce UTSW 9 62070567 missense probably damaging 0.99
R1436:Glce UTSW 9 62070010 splice site probably null
R1475:Glce UTSW 9 62060928 missense possibly damaging 0.75
R1622:Glce UTSW 9 62070561 missense possibly damaging 0.90
R1712:Glce UTSW 9 62070575 missense probably damaging 1.00
R1740:Glce UTSW 9 62070533 missense probably damaging 0.97
R2060:Glce UTSW 9 62060946 missense possibly damaging 0.83
R4424:Glce UTSW 9 62060253 missense probably damaging 1.00
R4893:Glce UTSW 9 62068495 missense probably benign
R5350:Glce UTSW 9 62060305 nonsense probably null
R5569:Glce UTSW 9 62070203 missense probably benign 0.35
R5666:Glce UTSW 9 62060511 missense probably damaging 1.00
R5670:Glce UTSW 9 62060511 missense probably damaging 1.00
R5743:Glce UTSW 9 62070540 missense probably damaging 1.00
R5909:Glce UTSW 9 62060144 missense probably damaging 1.00
R7091:Glce UTSW 9 62060588 missense probably damaging 1.00
R7139:Glce UTSW 9 62070434 nonsense probably null
R7549:Glce UTSW 9 62060993 missense probably damaging 1.00
R7854:Glce UTSW 9 62070491 missense probably benign 0.01
R7965:Glce UTSW 9 62060946 missense probably damaging 1.00
R8022:Glce UTSW 9 62060591 missense probably benign 0.08
R8264:Glce UTSW 9 62060430 missense probably benign
X0057:Glce UTSW 9 62060370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCTCACTAGCCAGTC -3'
(R):5'- CTTTGCAGCTGGGAAACAC -3'

Sequencing Primer
(F):5'- TAGCCAGTCACTTGCAGC -3'
(R):5'- CTTTGCAGCTGGGAAACACAAAAG -3'
Posted On2021-03-08