Incidental Mutation 'R8743:Psme4'
ID 663366
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8743 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30878467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1829 (L1829R)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: L1829R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: L1829R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,030 H121R probably benign Het
4930430A15Rik T C 2: 111,169,672 T198A unknown Het
Adam5 A T 8: 24,786,248 C468S probably damaging Het
Adamts7 G A 9: 90,195,243 R1321H probably damaging Het
Adra2c T C 5: 35,280,448 V188A possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ap1g1 A G 8: 109,837,791 N323D probably damaging Het
Arhgap15 A T 2: 43,748,864 probably benign Het
Arhgef33 T C 17: 80,360,453 probably null Het
Armc1 C T 3: 19,157,536 C40Y probably benign Het
Arsk C A 13: 76,066,809 V309F probably damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Cacna1s T C 1: 136,105,548 L1237P probably damaging Het
Ccnt2 A G 1: 127,774,283 E19G probably damaging Het
Ccr2 A C 9: 124,106,094 Y137S probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfh A T 1: 140,118,585 probably null Het
Chd5 T A 4: 152,366,405 V662E probably benign Het
Cnga4 A G 7: 105,408,013 D544G probably benign Het
Col6a3 C G 1: 90,767,606 probably benign Het
Coro6 T A 11: 77,466,439 I158N probably damaging Het
Cpa1 A G 6: 30,642,993 S307G probably damaging Het
Depdc5 T A 5: 32,924,243 M583K probably benign Het
Dock2 G T 11: 34,273,252 S1170* probably null Het
Dusp16 A T 6: 134,717,970 S633T probably benign Het
Esco1 T C 18: 10,572,123 E739G probably damaging Het
Fam193a T A 5: 34,420,157 probably null Het
Fam71e2 T A 7: 4,757,815 T633S Het
Fat4 G A 3: 38,888,443 S495N probably benign Het
Galnt10 A G 11: 57,784,583 Y556C probably damaging Het
Gc A T 5: 89,443,452 D142E probably benign Het
Gda A T 19: 21,400,588 F369Y probably damaging Het
Glce A T 9: 62,060,821 S349R probably benign Het
Glp2r A G 11: 67,722,075 L351P probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Gxylt2 A T 6: 100,787,323 Y323F probably benign Het
Hmmr T C 11: 40,708,031 N589D probably damaging Het
Hsd17b3 A C 13: 64,062,898 D214E probably benign Het
Kat6a A G 8: 22,939,006 D1459G possibly damaging Het
Lad1 G A 1: 135,831,195 R465H probably benign Het
Lcmt1 T A 7: 123,400,468 D46E probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Mylk G T 16: 34,921,057 R796L probably benign Het
Nat8l T A 5: 33,997,166 L108Q probably damaging Het
Nlrp5 T C 7: 23,418,747 V632A probably benign Het
Nr3c2 A G 8: 76,909,758 E496G probably damaging Het
Nucb2 A G 7: 116,528,830 D258G probably damaging Het
Olfr874 G T 9: 37,746,878 C248F probably benign Het
Olfr923 A T 9: 38,827,699 I3F probably benign Het
Papln A G 12: 83,782,990 K962E probably damaging Het
Pcdha8 T A 18: 36,994,319 M618K probably benign Het
Pclo A G 5: 14,714,566 D1066G Het
Phip A T 9: 82,927,087 M446K probably benign Het
Pkn3 A G 2: 30,083,306 K380R probably benign Het
Ppa1 C A 10: 61,660,979 A82E possibly damaging Het
Prune2 A C 19: 17,119,556 D808A probably benign Het
Rtp4 A C 16: 23,613,116 K133Q possibly damaging Het
Scaf11 C T 15: 96,415,788 A1371T probably benign Het
Serpinb9g A T 13: 33,494,948 H267L probably benign Het
Slc47a2 T G 11: 61,342,762 D6A probably benign Het
Slco1a4 A T 6: 141,819,529 V329D possibly damaging Het
Smg6 T C 11: 74,930,033 S377P probably benign Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,317,519 probably benign Het
Taar2 A T 10: 23,941,471 Y303F probably damaging Het
Tgm6 A G 2: 130,143,498 D407G probably damaging Het
Twf2 A G 9: 106,212,811 E153G possibly damaging Het
Upb1 A G 10: 75,439,876 Y365C probably damaging Het
Vmn2r4 A T 3: 64,409,826 S164T possibly damaging Het
Wtip C T 7: 34,125,554 G202R possibly damaging Het
Zfhx4 G A 3: 5,244,024 C770Y probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGTGAGAGCTGAGGTC -3'
(R):5'- GTCTCATCTTTGCTAAATTTGGGC -3'

Sequencing Primer
(F):5'- AGGTCTAGGTGGATACTAGTGTAAC -3'
(R):5'- GTGACACATAGCTGCAATCCTAGTG -3'
Posted On 2021-03-08