Mutagenetix > Incidental Mutation

Incidental Mutation 'R8744:Col6a3'

663390

Institutional Source

Beutler Lab

Gene Symbol

Col6a3

Ensembl Gene

ENSMUSG00000048126

Gene Name

collagen, type VI, alpha 3

Synonyms

Col6a-3

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8744 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90694582-90771710 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

C to G at 90695328 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000137585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000097653] [ENSMUST00000097653] [ENSMUST00000188587]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000056925

SMART Domains

Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
VWA	36	214	3.58e-42	SMART
VWA	239	415	3.34e-42	SMART
VWA	442	617	7.27e-43	SMART
VWA	636	813	7.8e-43	SMART
VWA	834	1010	4.21e-39	SMART
VWA	1024	1203	3.02e-40	SMART
VWA	1228	1406	1.1e-42	SMART
VWA	1431	1604	9.17e-40	SMART
VWA	1634	1807	1.78e-37	SMART
VWA	1833	2022	7.92e-3	SMART
Pfam:Collagen	2033	2094	2e-10	PFAM
Pfam:Collagen	2077	2142	2.8e-10	PFAM
low complexity region	2179	2222	N/A	INTRINSIC
low complexity region	2228	2279	N/A	INTRINSIC
Pfam:Collagen	2311	2373	7.9e-11	PFAM
VWA	2397	2576	3.95e-21	SMART
VWA	2614	2813	2.25e-25	SMART
low complexity region	2864	2880	N/A	INTRINSIC
low complexity region	2886	2900	N/A	INTRINSIC
low complexity region	2903	2941	N/A	INTRINSIC
low complexity region	2945	3024	N/A	INTRINSIC
low complexity region	3039	3076	N/A	INTRINSIC
low complexity region	3091	3103	N/A	INTRINSIC
FN3	3104	3183	4.6e-1	SMART
KU	3226	3279	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097653

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097653

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097653

SMART Domains

Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
VWA	35	210	7.27e-43	SMART
VWA	227	403	4.21e-39	SMART
VWA	417	596	3.02e-40	SMART
VWA	621	799	1.1e-42	SMART
VWA	824	997	9.17e-40	SMART
VWA	1027	1200	1.78e-37	SMART
VWA	1226	1415	7.92e-3	SMART
Pfam:Collagen	1426	1486	9.2e-10	PFAM
Pfam:Collagen	1473	1539	2.2e-9	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	3.95e-21	SMART
VWA	2007	2206	2.25e-25	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	4.6e-1	SMART
KU	2619	2672	4.34e-24	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188587

SMART Domains

Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWA	35	210	4.7e-45	SMART
VWA	227	403	2.7e-41	SMART
VWA	417	596	2e-42	SMART
VWA	621	799	7e-45	SMART
VWA	824	997	5.8e-42	SMART
VWA	1027	1200	1.1e-39	SMART
VWA	1226	1415	4.8e-5	SMART
Pfam:Collagen	1426	1486	3.8e-8	PFAM
Pfam:Collagen	1473	1539	9.1e-8	PFAM
low complexity region	1572	1615	N/A	INTRINSIC
low complexity region	1621	1672	N/A	INTRINSIC
low complexity region	1690	1704	N/A	INTRINSIC
low complexity region	1713	1734	N/A	INTRINSIC
VWA	1790	1969	2.4e-23	SMART
VWA	2007	2206	1.4e-27	SMART
low complexity region	2257	2273	N/A	INTRINSIC
low complexity region	2279	2293	N/A	INTRINSIC
low complexity region	2296	2334	N/A	INTRINSIC
low complexity region	2338	2417	N/A	INTRINSIC
low complexity region	2432	2469	N/A	INTRINSIC
low complexity region	2484	2496	N/A	INTRINSIC
FN3	2497	2576	2.2e-3	SMART
KU	2619	2672	2.1e-26	SMART

Meta Mutation Damage Score

0.1228

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	C	A	11: 58,182,260 (GRCm39)		probably null	Het
Adam2	A	G	14: 66,272,165 (GRCm39)		probably null	Het
Akt2	A	T	7: 27,317,738 (GRCm39)	D94V	probably benign	Het
Anapc7	C	T	5: 122,566,211 (GRCm39)	S40L	probably benign	Het
Ash1l	G	T	3: 88,965,890 (GRCm39)	A2431S	possibly damaging	Het
Atoh1	A	T	6: 64,706,902 (GRCm39)	Q199L	probably damaging	Het
Atp10b	T	C	11: 43,121,177 (GRCm39)	C947R	probably damaging	Het
Ccdc50	G	A	16: 27,255,148 (GRCm39)	V199I	possibly damaging	Het
Ccne1	A	T	7: 37,802,598 (GRCm39)	C65S	probably benign	Het
Cep152	A	G	2: 125,436,791 (GRCm39)		probably null	Het
Cyp4a10	A	G	4: 115,386,667 (GRCm39)	D438G	probably benign	Het
Dgkb	A	G	12: 38,488,611 (GRCm39)	H659R	probably damaging	Het
Dhx29	A	G	13: 113,089,418 (GRCm39)	I730V	possibly damaging	Het
Dync2h1	G	A	9: 7,011,220 (GRCm39)	Q3658*	probably null	Het
Eif2ak4	C	A	2: 118,261,474 (GRCm39)	C671*	probably null	Het
Eif4g3	AGCGGCGGCGGCGGCGGC	AGCGGCGGCGGCGGC	4: 137,721,372 (GRCm39)		probably benign	Het
Ep400	T	C	5: 110,889,925 (GRCm39)	H446R	unknown	Het
Epb41l2	C	T	10: 25,317,725 (GRCm39)	L81F	probably damaging	Het
Ercc8	G	A	13: 108,320,307 (GRCm39)	A298T	probably benign	Het
Fbxo10	T	C	4: 45,043,880 (GRCm39)	M648V	probably benign	Het
G530012D18Rik	C	G	1: 85,504,935 (GRCm39)	D113E	unknown	Het
Gnpda2	C	T	5: 69,735,459 (GRCm39)	A211T	probably damaging	Het
Gtf2h5	C	CA	17: 6,134,833 (GRCm39)		probably null	Het
Hormad1	T	C	3: 95,469,926 (GRCm39)	Y58H	possibly damaging	Het
Igkv4-81	T	C	6: 68,968,046 (GRCm39)	I18M	possibly damaging	Het
Itgav	G	T	2: 83,600,427 (GRCm39)	A312S	probably benign	Het
Itpr1	G	T	6: 108,354,763 (GRCm39)	A457S	possibly damaging	Het
Kcna10	T	C	3: 107,101,702 (GRCm39)	L111P	probably damaging	Het
Kcnh7	T	C	2: 63,012,433 (GRCm39)	R92G	possibly damaging	Het
Lamc2	G	A	1: 153,019,484 (GRCm39)	P486S	probably benign	Het
Lrba	C	T	3: 86,211,640 (GRCm39)	T420M	probably benign	Het
Lrrc52	G	A	1: 167,294,150 (GRCm39)	T45M	probably benign	Het
Lsm8	C	A	6: 18,853,638 (GRCm39)	A80E	probably benign	Het
Ly6g	T	A	15: 75,027,518 (GRCm39)	S9T	probably benign	Het
Mcc	A	G	18: 44,857,639 (GRCm39)	Y159H	probably benign	Het
Megf11	T	C	9: 64,451,970 (GRCm39)		probably null	Het
Mrpl9	T	A	3: 94,355,082 (GRCm39)		probably benign	Het
Ndst4	T	C	3: 125,506,989 (GRCm39)	F210L	possibly damaging	Het
Or13l2	A	G	3: 97,317,597 (GRCm39)	V300A	probably benign	Het
Or5d40	T	A	2: 88,015,723 (GRCm39)	C167*	probably null	Het
Pappa2	A	G	1: 158,611,487 (GRCm39)	V1492A	possibly damaging	Het
Pcdhga2	A	G	18: 37,804,373 (GRCm39)	H739R	probably benign	Het
Pcdhga8	A	G	18: 37,860,827 (GRCm39)	T628A	probably damaging	Het
Plekhn1	C	T	4: 156,318,364 (GRCm39)	R86H	probably damaging	Het
Pofut1	T	A	2: 153,101,461 (GRCm39)	W72R	probably benign	Het
Polr3b	C	A	10: 84,464,488 (GRCm39)		probably benign	Het
Rab3b	A	T	4: 108,781,184 (GRCm39)	I104F	probably damaging	Het
Rab5b	A	T	10: 128,518,751 (GRCm39)	V127D	probably damaging	Het
Rnf170	A	G	8: 26,619,408 (GRCm39)	M211V	unknown	Het
Rpl7	T	C	1: 16,172,113 (GRCm39)	T218A	probably benign	Het
Serinc2	T	C	4: 130,158,988 (GRCm39)		probably benign	Het
Socs2	T	A	10: 95,228,662 (GRCm39)	Q196L		Het
Stab2	T	C	10: 86,805,213 (GRCm39)	H255R	probably benign	Het
Syvn1	G	A	19: 6,099,198 (GRCm39)	G149D	probably damaging	Het
Them5	T	C	3: 94,253,472 (GRCm39)	S161P	probably damaging	Het
Tlr1	A	T	5: 65,083,873 (GRCm39)	Y235N	possibly damaging	Het
Toporsl	T	C	4: 52,611,967 (GRCm39)	L620P	probably benign	Het
Traf3	A	T	12: 111,228,230 (GRCm39)	E480D	probably benign	Het
Trav13n-4	A	G	14: 53,601,399 (GRCm39)	Y56C	probably damaging	Het
Trps1	T	C	15: 50,524,642 (GRCm39)	Y1096C	probably damaging	Het
Usp2	A	G	9: 43,998,510 (GRCm39)		probably benign	Het
Usp40	A	T	1: 87,911,491 (GRCm39)	L512Q	probably benign	Het
Vmn1r175	T	C	7: 23,508,403 (GRCm39)	T75A	probably benign	Het
Zan	A	G	5: 137,426,126 (GRCm39)	V2550A	unknown	Het
Zfp235	A	T	7: 23,839,924 (GRCm39)	E114D	possibly damaging	Het
Zmym1	A	T	4: 126,945,165 (GRCm39)	D141E	probably damaging	Het

Other mutations in Col6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Col6a3	APN	1	90,755,977 (GRCm39)	missense	probably damaging	1.00
IGL00425:Col6a3	APN	1	90,709,748 (GRCm39)	missense	unknown
IGL00541:Col6a3	APN	1	90,729,864 (GRCm39)	missense	possibly damaging	0.83
IGL01063:Col6a3	APN	1	90,730,054 (GRCm39)	missense	probably damaging	1.00
IGL01094:Col6a3	APN	1	90,731,655 (GRCm39)	missense	possibly damaging	0.93
IGL01138:Col6a3	APN	1	90,735,232 (GRCm39)	missense	probably damaging	1.00
IGL01291:Col6a3	APN	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL01674:Col6a3	APN	1	90,730,236 (GRCm39)	missense	probably damaging	1.00
IGL01756:Col6a3	APN	1	90,706,884 (GRCm39)	missense	unknown
IGL01827:Col6a3	APN	1	90,730,041 (GRCm39)	missense	probably damaging	1.00
IGL01845:Col6a3	APN	1	90,724,293 (GRCm39)	missense	probably damaging	1.00
IGL01869:Col6a3	APN	1	90,700,770 (GRCm39)	missense	unknown
IGL01900:Col6a3	APN	1	90,722,732 (GRCm39)	critical splice donor site	probably null
IGL01925:Col6a3	APN	1	90,729,958 (GRCm39)	missense	possibly damaging	0.95
IGL02002:Col6a3	APN	1	90,709,858 (GRCm39)	splice site	probably benign
IGL02115:Col6a3	APN	1	90,735,373 (GRCm39)	missense	probably damaging	0.99
IGL02302:Col6a3	APN	1	90,709,482 (GRCm39)	missense	unknown
IGL02313:Col6a3	APN	1	90,739,328 (GRCm39)	missense	probably damaging	1.00
IGL02458:Col6a3	APN	1	90,706,919 (GRCm39)	missense	unknown
IGL02821:Col6a3	APN	1	90,731,600 (GRCm39)	missense	probably damaging	1.00
IGL02828:Col6a3	APN	1	90,724,281 (GRCm39)	missense	probably damaging	1.00
IGL03112:Col6a3	APN	1	90,739,242 (GRCm39)	nonsense	probably null
IGL03129:Col6a3	APN	1	90,749,584 (GRCm39)	missense	probably damaging	1.00
IGL03132:Col6a3	APN	1	90,731,615 (GRCm39)	missense	probably damaging	1.00
IGL03148:Col6a3	APN	1	90,755,588 (GRCm39)	missense	probably benign	0.33
IGL03251:Col6a3	APN	1	90,737,898 (GRCm39)	missense	probably damaging	1.00
bailey	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
barnum	UTSW	1	90,706,874 (GRCm39)	missense	unknown
Boneless	UTSW	1	90,706,781 (GRCm39)	missense	unknown
Noodloid	UTSW	1	90,707,011 (GRCm39)	missense	unknown
randolf	UTSW	1	90,715,673 (GRCm39)	missense	unknown
stringy	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
wonder	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
ANU05:Col6a3	UTSW	1	90,730,014 (GRCm39)	missense	probably damaging	1.00
IGL03048:Col6a3	UTSW	1	90,737,970 (GRCm39)	missense	possibly damaging	0.58
PIT4810001:Col6a3	UTSW	1	90,706,516 (GRCm39)	missense	unknown
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0020:Col6a3	UTSW	1	90,739,272 (GRCm39)	missense	probably damaging	0.99
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0033:Col6a3	UTSW	1	90,729,967 (GRCm39)	missense	probably damaging	1.00
R0105:Col6a3	UTSW	1	90,725,883 (GRCm39)	missense	possibly damaging	0.65
R0116:Col6a3	UTSW	1	90,741,273 (GRCm39)	missense	probably damaging	1.00
R0167:Col6a3	UTSW	1	90,725,895 (GRCm39)	missense	probably damaging	1.00
R0319:Col6a3	UTSW	1	90,735,426 (GRCm39)	missense	possibly damaging	0.95
R0348:Col6a3	UTSW	1	90,755,771 (GRCm39)	missense	probably damaging	1.00
R0365:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R0512:Col6a3	UTSW	1	90,749,520 (GRCm39)	intron	probably benign
R0564:Col6a3	UTSW	1	90,735,456 (GRCm39)	missense	probably damaging	1.00
R0635:Col6a3	UTSW	1	90,735,808 (GRCm39)	splice site	probably null
R0667:Col6a3	UTSW	1	90,755,823 (GRCm39)	missense	probably damaging	0.98
R0680:Col6a3	UTSW	1	90,706,703 (GRCm39)	missense	unknown
R0736:Col6a3	UTSW	1	90,731,811 (GRCm39)	missense	possibly damaging	0.95
R0737:Col6a3	UTSW	1	90,756,020 (GRCm39)	missense	probably damaging	1.00
R0747:Col6a3	UTSW	1	90,730,375 (GRCm39)	missense	probably damaging	1.00
R1155:Col6a3	UTSW	1	90,722,047 (GRCm39)	missense	probably null	1.00
R1169:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	possibly damaging	0.67
R1180:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1225:Col6a3	UTSW	1	90,739,238 (GRCm39)	missense	probably damaging	1.00
R1343:Col6a3	UTSW	1	90,696,069 (GRCm39)	missense	unknown
R1387:Col6a3	UTSW	1	90,750,138 (GRCm39)	intron	probably benign
R1437:Col6a3	UTSW	1	90,729,098 (GRCm39)	missense	probably damaging	1.00
R1448:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R1677:Col6a3	UTSW	1	90,749,583 (GRCm39)	missense	probably benign	0.14
R1681:Col6a3	UTSW	1	90,701,224 (GRCm39)	missense	unknown
R1711:Col6a3	UTSW	1	90,757,935 (GRCm39)	missense	probably damaging	1.00
R1727:Col6a3	UTSW	1	90,724,296 (GRCm39)	critical splice acceptor site	probably null
R1736:Col6a3	UTSW	1	90,706,781 (GRCm39)	missense	unknown
R1738:Col6a3	UTSW	1	90,744,083 (GRCm39)	missense	probably damaging	1.00
R1742:Col6a3	UTSW	1	90,741,516 (GRCm39)	missense	probably damaging	1.00
R1809:Col6a3	UTSW	1	90,755,671 (GRCm39)	missense	probably damaging	1.00
R1851:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1852:Col6a3	UTSW	1	90,735,256 (GRCm39)	missense	possibly damaging	0.69
R1872:Col6a3	UTSW	1	90,757,936 (GRCm39)	missense	probably damaging	0.96
R1889:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1895:Col6a3	UTSW	1	90,731,433 (GRCm39)	missense	probably benign	0.00
R1908:Col6a3	UTSW	1	90,739,421 (GRCm39)	missense	probably damaging	1.00
R1919:Col6a3	UTSW	1	90,750,081 (GRCm39)	missense	possibly damaging	0.66
R1973:Col6a3	UTSW	1	90,731,897 (GRCm39)	missense	probably damaging	1.00
R2083:Col6a3	UTSW	1	90,709,733 (GRCm39)	missense	unknown
R2121:Col6a3	UTSW	1	90,738,087 (GRCm39)	missense	probably damaging	1.00
R2197:Col6a3	UTSW	1	90,731,467 (GRCm39)	missense	probably benign	0.09
R2448:Col6a3	UTSW	1	90,741,080 (GRCm39)	missense	probably damaging	1.00
R2831:Col6a3	UTSW	1	90,731,435 (GRCm39)	missense	possibly damaging	0.89
R2877:Col6a3	UTSW	1	90,703,321 (GRCm39)	missense	unknown
R3052:Col6a3	UTSW	1	90,729,852 (GRCm39)	missense	possibly damaging	0.71
R3104:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3105:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3106:Col6a3	UTSW	1	90,744,024 (GRCm39)	missense	probably damaging	0.99
R3418:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3419:Col6a3	UTSW	1	90,731,813 (GRCm39)	missense	probably benign	0.42
R3837:Col6a3	UTSW	1	90,707,803 (GRCm39)	missense	unknown
R4007:Col6a3	UTSW	1	90,730,291 (GRCm39)	missense	probably damaging	1.00
R4082:Col6a3	UTSW	1	90,749,605 (GRCm39)	missense	probably damaging	1.00
R4181:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4200:Col6a3	UTSW	1	90,729,105 (GRCm39)	missense	probably benign	0.28
R4244:Col6a3	UTSW	1	90,714,361 (GRCm39)	missense	unknown
R4297:Col6a3	UTSW	1	90,739,100 (GRCm39)	missense	probably damaging	1.00
R4302:Col6a3	UTSW	1	90,735,336 (GRCm39)	missense	probably damaging	1.00
R4472:Col6a3	UTSW	1	90,749,736 (GRCm39)	missense	probably benign	0.23
R4600:Col6a3	UTSW	1	90,709,626 (GRCm39)	missense	unknown
R4683:Col6a3	UTSW	1	90,701,179 (GRCm39)	missense	unknown
R4788:Col6a3	UTSW	1	90,700,672 (GRCm39)	critical splice donor site	probably null
R4851:Col6a3	UTSW	1	90,707,011 (GRCm39)	missense	unknown
R4899:Col6a3	UTSW	1	90,730,149 (GRCm39)	missense	probably damaging	0.99
R4904:Col6a3	UTSW	1	90,729,164 (GRCm39)	missense	probably damaging	1.00
R4908:Col6a3	UTSW	1	90,735,246 (GRCm39)	missense	probably damaging	1.00
R4960:Col6a3	UTSW	1	90,731,940 (GRCm39)	missense	probably damaging	1.00
R4981:Col6a3	UTSW	1	90,706,565 (GRCm39)	missense	unknown
R5057:Col6a3	UTSW	1	90,743,852 (GRCm39)	missense	possibly damaging	0.91
R5062:Col6a3	UTSW	1	90,707,074 (GRCm39)	missense	unknown
R5105:Col6a3	UTSW	1	90,725,862 (GRCm39)	missense	possibly damaging	0.81
R5127:Col6a3	UTSW	1	90,696,067 (GRCm39)	missense	unknown
R5166:Col6a3	UTSW	1	90,738,330 (GRCm39)	missense	probably damaging	1.00
R5168:Col6a3	UTSW	1	90,701,361 (GRCm39)	nonsense	probably null
R5196:Col6a3	UTSW	1	90,744,260 (GRCm39)	splice site	probably null
R5230:Col6a3	UTSW	1	90,716,776 (GRCm39)	missense	unknown
R5268:Col6a3	UTSW	1	90,712,965 (GRCm39)	missense	unknown
R5381:Col6a3	UTSW	1	90,703,334 (GRCm39)	missense	unknown
R5392:Col6a3	UTSW	1	90,729,017 (GRCm39)	missense	probably benign	0.41
R5445:Col6a3	UTSW	1	90,709,761 (GRCm39)	nonsense	probably null
R5571:Col6a3	UTSW	1	90,715,938 (GRCm39)	missense	unknown
R5665:Col6a3	UTSW	1	90,755,602 (GRCm39)	missense	probably benign	0.00
R5902:Col6a3	UTSW	1	90,729,921 (GRCm39)	splice site	probably null
R5914:Col6a3	UTSW	1	90,703,922 (GRCm39)	missense	unknown
R5955:Col6a3	UTSW	1	90,739,163 (GRCm39)	missense	probably damaging	1.00
R5977:Col6a3	UTSW	1	90,749,571 (GRCm39)	missense	possibly damaging	0.82
R6006:Col6a3	UTSW	1	90,696,105 (GRCm39)	missense	unknown
R6010:Col6a3	UTSW	1	90,701,219 (GRCm39)	missense	unknown
R6025:Col6a3	UTSW	1	90,755,824 (GRCm39)	missense	probably damaging	1.00
R6151:Col6a3	UTSW	1	90,741,475 (GRCm39)	missense	possibly damaging	0.53
R6154:Col6a3	UTSW	1	90,701,387 (GRCm39)	missense	unknown
R6181:Col6a3	UTSW	1	90,744,096 (GRCm39)	missense	possibly damaging	0.95
R6197:Col6a3	UTSW	1	90,750,063 (GRCm39)	missense	probably damaging	1.00
R6332:Col6a3	UTSW	1	90,749,955 (GRCm39)	missense	probably damaging	1.00
R6362:Col6a3	UTSW	1	90,738,285 (GRCm39)	missense	probably damaging	0.99
R6476:Col6a3	UTSW	1	90,709,534 (GRCm39)	missense	unknown
R6484:Col6a3	UTSW	1	90,719,645 (GRCm39)	critical splice donor site	probably null
R6701:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6702:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6703:Col6a3	UTSW	1	90,720,184 (GRCm39)	missense	probably benign	0.14
R6703:Col6a3	UTSW	1	90,707,161 (GRCm39)	missense	unknown
R6724:Col6a3	UTSW	1	90,706,874 (GRCm39)	missense	unknown
R6746:Col6a3	UTSW	1	90,706,767 (GRCm39)	missense	unknown
R6797:Col6a3	UTSW	1	90,731,810 (GRCm39)	missense	probably damaging	0.99
R6798:Col6a3	UTSW	1	90,722,731 (GRCm39)	splice site	probably null
R6903:Col6a3	UTSW	1	90,721,929 (GRCm39)	missense	probably damaging	1.00
R6925:Col6a3	UTSW	1	90,743,724 (GRCm39)	missense	probably benign	0.00
R6978:Col6a3	UTSW	1	90,735,192 (GRCm39)	critical splice donor site	probably null
R7058:Col6a3	UTSW	1	90,755,759 (GRCm39)	nonsense	probably null
R7182:Col6a3	UTSW	1	90,731,400 (GRCm39)	nonsense	probably null
R7294:Col6a3	UTSW	1	90,756,005 (GRCm39)	missense	probably damaging	1.00
R7296:Col6a3	UTSW	1	90,755,708 (GRCm39)	missense	probably benign	0.00
R7311:Col6a3	UTSW	1	90,750,013 (GRCm39)	missense	probably damaging	1.00
R7412:Col6a3	UTSW	1	90,755,855 (GRCm39)	missense	probably damaging	0.98
R7561:Col6a3	UTSW	1	90,703,463 (GRCm39)	missense	unknown
R7575:Col6a3	UTSW	1	90,738,321 (GRCm39)	missense	possibly damaging	0.92
R7659:Col6a3	UTSW	1	90,709,467 (GRCm39)	missense	unknown
R7679:Col6a3	UTSW	1	90,739,473 (GRCm39)	missense	possibly damaging	0.49
R7831:Col6a3	UTSW	1	90,724,268 (GRCm39)	nonsense	probably null
R7855:Col6a3	UTSW	1	90,738,343 (GRCm39)	missense	possibly damaging	0.57
R7990:Col6a3	UTSW	1	90,709,577 (GRCm39)	missense	unknown
R8003:Col6a3	UTSW	1	90,703,455 (GRCm39)	missense	unknown
R8007:Col6a3	UTSW	1	90,705,179 (GRCm39)	missense	unknown
R8098:Col6a3	UTSW	1	90,731,383 (GRCm39)	missense	probably benign
R8312:Col6a3	UTSW	1	90,741,412 (GRCm39)	missense	possibly damaging	0.55
R8419:Col6a3	UTSW	1	90,729,935 (GRCm39)	missense	probably damaging	1.00
R8723:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8725:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8737:Col6a3	UTSW	1	90,727,747 (GRCm39)	missense	probably benign	0.10
R8742:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8743:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8753:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8754:Col6a3	UTSW	1	90,695,328 (GRCm39)	critical splice acceptor site	probably benign
R8773:Col6a3	UTSW	1	90,696,171 (GRCm39)	missense	unknown
R8857:Col6a3	UTSW	1	90,703,485 (GRCm39)	missense	unknown
R8867:Col6a3	UTSW	1	90,715,673 (GRCm39)	missense	unknown
R8887:Col6a3	UTSW	1	90,755,948 (GRCm39)	missense	probably benign
R9011:Col6a3	UTSW	1	90,710,057 (GRCm39)	splice site	probably benign
R9049:Col6a3	UTSW	1	90,707,066 (GRCm39)	missense	unknown
R9142:Col6a3	UTSW	1	90,706,566 (GRCm39)	missense	unknown
R9155:Col6a3	UTSW	1	90,738,301 (GRCm39)	missense	probably benign	0.27
R9249:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9258:Col6a3	UTSW	1	90,700,703 (GRCm39)	missense	unknown
R9274:Col6a3	UTSW	1	90,707,020 (GRCm39)	missense	unknown
R9276:Col6a3	UTSW	1	90,735,403 (GRCm39)	missense	possibly damaging	0.94
R9315:Col6a3	UTSW	1	90,738,979 (GRCm39)	critical splice donor site	probably null
R9376:Col6a3	UTSW	1	90,709,523 (GRCm39)	missense	unknown
R9377:Col6a3	UTSW	1	90,743,961 (GRCm39)	missense	probably damaging	1.00
R9429:Col6a3	UTSW	1	90,731,585 (GRCm39)	missense	probably benign	0.01
R9439:Col6a3	UTSW	1	90,744,155 (GRCm39)	missense	probably damaging	1.00
R9440:Col6a3	UTSW	1	90,707,068 (GRCm39)	missense	unknown
R9441:Col6a3	UTSW	1	90,705,249 (GRCm39)	nonsense	probably null
R9477:Col6a3	UTSW	1	90,706,621 (GRCm39)	missense	unknown
R9498:Col6a3	UTSW	1	90,713,650 (GRCm39)	nonsense	probably null
R9528:Col6a3	UTSW	1	90,731,789 (GRCm39)	missense	probably damaging	1.00
R9602:Col6a3	UTSW	1	90,731,497 (GRCm39)	missense	probably benign	0.07
RF005:Col6a3	UTSW	1	90,738,984 (GRCm39)	missense	probably benign	0.00
RF012:Col6a3	UTSW	1	90,738,282 (GRCm39)	missense	probably damaging	1.00
X0024:Col6a3	UTSW	1	90,731,359 (GRCm39)	critical splice donor site	probably null
X0063:Col6a3	UTSW	1	90,731,627 (GRCm39)	missense	probably damaging	1.00
X0067:Col6a3	UTSW	1	90,739,251 (GRCm39)	missense	probably damaging	1.00
Z1177:Col6a3	UTSW	1	90,739,450 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TAGCACCATATTGACAGGTCACG -3'
(R):5'- AGTTCAGATTCCACACGGCC -3'

Sequencing Primer
(F):5'- CCATATTGACAGGTCACGTGCAG -3'
(R):5'- CGGCCCAAACCTGAAGC -3'

Posted On

2021-03-08