Incidental Mutation 'R8744:Kcna10'
ID663405
Institutional Source Beutler Lab
Gene Symbol Kcna10
Ensembl Gene ENSMUSG00000042861
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 10
SynonymsKcna8, Kv1.8
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R8744 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107183056-107195721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107194386 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000088118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055064]
Predicted Effect probably damaging
Transcript: ENSMUST00000055064
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088118
Gene: ENSMUSG00000042861
AA Change: L111P

DomainStartEndE-ValueType
BTB 86 186 1.07e-6 SMART
Pfam:Ion_trans 215 468 3.4e-51 PFAM
Pfam:Ion_trans_2 376 461 6.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significant vestibular and mild hearing dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
Adam2 A G 14: 66,034,716 probably null Het
Akt2 A T 7: 27,618,313 D94V probably benign Het
Anapc7 C T 5: 122,428,148 S40L probably benign Het
Ash1l G T 3: 89,058,583 A2431S possibly damaging Het
Atoh1 A T 6: 64,729,918 Q199L probably damaging Het
Atp10b T C 11: 43,230,350 C947R probably damaging Het
Ccdc50 G A 16: 27,436,398 V199I possibly damaging Het
Ccne1 A T 7: 38,103,173 C65S probably benign Het
Cep152 A G 2: 125,594,871 probably null Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cyp4a10 A G 4: 115,529,470 D438G probably benign Het
Dgkb A G 12: 38,438,612 H659R probably damaging Het
Dhx29 A G 13: 112,952,884 I730V possibly damaging Het
Dync2h1 G A 9: 7,011,220 Q3658* probably null Het
Eif2ak4 C A 2: 118,430,993 C671* probably null Het
Eif4g3 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 4: 137,994,061 probably benign Het
Ep400 T C 5: 110,742,059 H446R unknown Het
Epb41l2 C T 10: 25,441,827 L81F probably damaging Het
Ercc8 G A 13: 108,183,773 A298T probably benign Het
Fbxo10 T C 4: 45,043,880 M648V probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gnpda2 C T 5: 69,578,116 A211T probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hormad1 T C 3: 95,562,615 Y58H possibly damaging Het
Igkv4-81 T C 6: 68,991,062 I18M possibly damaging Het
Itgav G T 2: 83,770,083 A312S probably benign Het
Itpr1 G T 6: 108,377,802 A457S possibly damaging Het
Kcnh7 T C 2: 63,182,089 R92G possibly damaging Het
Lamc2 G A 1: 153,143,738 P486S probably benign Het
Lrba C T 3: 86,304,333 T420M probably benign Het
Lrrc52 G A 1: 167,466,581 T45M probably benign Het
Lsm8 C A 6: 18,853,639 A80E probably benign Het
Ly6g T A 15: 75,155,669 S9T probably benign Het
Mcc A G 18: 44,724,572 Y159H probably benign Het
Megf11 T C 9: 64,544,688 probably null Het
Ndst4 T C 3: 125,713,340 F210L possibly damaging Het
Olfr1168 T A 2: 88,185,379 C167* probably null Het
Olfr1402 A G 3: 97,410,281 V300A probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pcdhga2 A G 18: 37,671,320 H739R probably benign Het
Pcdhga8 A G 18: 37,727,774 T628A probably damaging Het
Plekhn1 C T 4: 156,233,907 R86H probably damaging Het
Pofut1 T A 2: 153,259,541 W72R probably benign Het
Rab3b A T 4: 108,923,987 I104F probably damaging Het
Rab5b A T 10: 128,682,882 V127D probably damaging Het
Rnf170 A G 8: 26,129,380 M211V unknown Het
Rpl7 T C 1: 16,101,889 T218A probably benign Het
Serinc2 T C 4: 130,265,195 probably benign Het
Socs2 T A 10: 95,392,800 Q196L Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Syvn1 G A 19: 6,049,168 G149D probably damaging Het
Them5 T C 3: 94,346,165 S161P probably damaging Het
Tlr1 A T 5: 64,926,530 Y235N possibly damaging Het
Toporsl T C 4: 52,611,967 L620P probably benign Het
Traf3 A T 12: 111,261,796 E480D probably benign Het
Trav13n-4 A G 14: 53,363,942 Y56C probably damaging Het
Trps1 T C 15: 50,661,246 Y1096C probably damaging Het
Usp40 A T 1: 87,983,769 L512Q probably benign Het
Vmn1r175 T C 7: 23,808,978 T75A probably benign Het
Zan A G 5: 137,427,864 V2550A unknown Het
Zfp235 A T 7: 24,140,499 E114D possibly damaging Het
Zmym1 A T 4: 127,051,372 D141E probably damaging Het
Other mutations in Kcna10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Kcna10 APN 3 107194728 missense probably damaging 1.00
IGL00481:Kcna10 APN 3 107195514 missense probably benign
IGL00645:Kcna10 APN 3 107195465 missense possibly damaging 0.95
IGL00974:Kcna10 APN 3 107195331 missense probably damaging 1.00
IGL03108:Kcna10 APN 3 107194943 missense probably benign 0.00
R0020:Kcna10 UTSW 3 107195420 missense probably damaging 1.00
R0421:Kcna10 UTSW 3 107194504 missense probably damaging 1.00
R0811:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R0812:Kcna10 UTSW 3 107195259 missense possibly damaging 0.89
R2176:Kcna10 UTSW 3 107194716 missense probably damaging 1.00
R4405:Kcna10 UTSW 3 107195465 missense possibly damaging 0.95
R4668:Kcna10 UTSW 3 107194694 missense possibly damaging 0.83
R4703:Kcna10 UTSW 3 107194610 missense probably benign 0.22
R4719:Kcna10 UTSW 3 107194901 missense probably benign
R4736:Kcna10 UTSW 3 107195492 missense probably benign
R5227:Kcna10 UTSW 3 107194428 missense probably damaging 1.00
R5564:Kcna10 UTSW 3 107194229 missense probably benign
R5735:Kcna10 UTSW 3 107195078 missense probably benign
R7418:Kcna10 UTSW 3 107195046 missense probably benign 0.12
R7464:Kcna10 UTSW 3 107194079 missense probably damaging 0.99
R7699:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7700:Kcna10 UTSW 3 107195540 missense probably damaging 1.00
R7978:Kcna10 UTSW 3 107194347 missense probably damaging 1.00
R8068:Kcna10 UTSW 3 107194410 missense possibly damaging 0.58
X0026:Kcna10 UTSW 3 107195157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTTGACCCAACCAGCTC -3'
(R):5'- CATAGAAGGAGATCTCATCAGCG -3'

Sequencing Primer
(F):5'- CCAATTGGAGAGTCCTTATCAGTGAC -3'
(R):5'- GGAGATCTCATCAGCGAAAACATC -3'
Posted On2021-03-08