Incidental Mutation 'R0420:Zic2'
ID 66342
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Name zinc finger protein of the cerebellum 2
Synonyms odd-paired homolog, GENA 29, Ku
MMRRC Submission 038622-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.899) question?
Stock # R0420 (G1)
Quality Score 135
Status Validated
Chromosome 14
Chromosomal Location 122712847-122717264 bp(+) (GRCm39)
Type of Mutation small deletion (2 aa in frame mutation)
DNA Base Change (assembly) CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075888
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,991,050 (GRCm39) V870A probably benign Het
Adam6b A T 12: 113,453,614 (GRCm39) M144L probably benign Het
Adrb2 T A 18: 62,312,610 (GRCm39) I72L possibly damaging Het
Ankrd53 A T 6: 83,740,674 (GRCm39) H99L probably damaging Het
Ap4e1 C T 2: 126,891,280 (GRCm39) T17M probably damaging Het
Arnt T A 3: 95,377,705 (GRCm39) probably benign Het
Atp1a3 C T 7: 24,680,052 (GRCm39) G884E probably benign Het
Atp6v1b1 T C 6: 83,729,826 (GRCm39) probably benign Het
Atp8a2 G T 14: 60,011,193 (GRCm39) T971K probably damaging Het
BC048562 A T 9: 108,323,165 (GRCm39) T167S probably benign Het
Brd9 A G 13: 74,103,592 (GRCm39) M491V probably benign Het
Btnl10 A T 11: 58,814,277 (GRCm39) D319V probably damaging Het
Cadps T A 14: 12,491,800 (GRCm38) R783S probably damaging Het
Ccdc149 A G 5: 52,557,581 (GRCm39) probably benign Het
Ccm2l A T 2: 152,912,782 (GRCm39) D107V probably null Het
Cep192 A G 18: 67,946,964 (GRCm39) E213G possibly damaging Het
Cyp2c37 A C 19: 39,984,238 (GRCm39) N242T probably benign Het
Dnah17 A G 11: 117,930,765 (GRCm39) V3750A probably damaging Het
Ehbp1 T A 11: 22,101,836 (GRCm39) I231L probably benign Het
Emilin3 A G 2: 160,752,799 (GRCm39) probably benign Het
Eya4 T C 10: 23,031,861 (GRCm39) N254S possibly damaging Het
Fam184b A G 5: 45,741,854 (GRCm39) S126P probably damaging Het
Fancd2 T C 6: 113,513,940 (GRCm39) L108P probably damaging Het
Fgf12 A T 16: 27,981,281 (GRCm39) M145K possibly damaging Het
Gabbr1 A G 17: 37,357,654 (GRCm39) N23S possibly damaging Het
Ggt1 T A 10: 75,412,047 (GRCm39) probably benign Het
Gm6434 T A 7: 25,581,786 (GRCm39) noncoding transcript Het
Grik4 A T 9: 42,533,392 (GRCm39) L376* probably null Het
Gvin3 T A 7: 106,203,090 (GRCm39) L51F probably damaging Het
Gzf1 A G 2: 148,525,753 (GRCm39) T75A probably benign Het
Hcn1 T C 13: 118,111,911 (GRCm39) I625T unknown Het
Hhat C T 1: 192,235,242 (GRCm39) probably null Het
Ifit1bl1 T C 19: 34,571,914 (GRCm39) E181G probably damaging Het
Kif21a T C 15: 90,852,257 (GRCm39) probably benign Het
Lrrc45 A C 11: 120,606,045 (GRCm39) S118R probably damaging Het
Mcm9 T C 10: 53,424,623 (GRCm39) I656V probably benign Het
Ms4a5 A G 19: 11,261,018 (GRCm39) L47S probably damaging Het
Mynn A T 3: 30,661,608 (GRCm39) N230I probably benign Het
Nck2 T C 1: 43,593,278 (GRCm39) S162P probably damaging Het
Nfat5 T C 8: 108,094,093 (GRCm39) F259S probably damaging Het
Obox1 T G 7: 15,290,178 (GRCm39) S174A possibly damaging Het
Ociad1 T A 5: 73,470,772 (GRCm39) probably null Het
Pgbd1 A T 13: 21,607,336 (GRCm39) V286E possibly damaging Het
Phlpp2 T C 8: 110,666,567 (GRCm39) V1032A probably damaging Het
Ppm1e C T 11: 87,131,440 (GRCm39) A318T probably damaging Het
Prex1 T A 2: 166,431,491 (GRCm39) D757V probably benign Het
Ptpdc1 C A 13: 48,742,595 (GRCm39) probably null Het
Rbbp5 T G 1: 132,421,582 (GRCm39) I94R possibly damaging Het
Rnpc3 A G 3: 113,415,518 (GRCm39) V173A probably benign Het
Sgsm1 A T 5: 113,411,625 (GRCm39) N700K probably benign Het
Slco1a8 T G 6: 141,931,203 (GRCm39) probably benign Het
Sox14 T A 9: 99,757,175 (GRCm39) H188L probably damaging Het
Spmip11 A G 15: 98,468,975 (GRCm39) S17G probably benign Het
Supt5 T A 7: 28,016,754 (GRCm39) probably benign Het
Synpo A G 18: 60,735,490 (GRCm39) S819P probably damaging Het
Tenm2 A G 11: 36,097,951 (GRCm39) probably benign Het
Tenm4 T C 7: 96,522,973 (GRCm39) V1468A possibly damaging Het
Tiam2 A G 17: 3,553,193 (GRCm39) N83S probably benign Het
Tle6 T C 10: 81,431,145 (GRCm39) probably benign Het
Tm2d2 T G 8: 25,508,130 (GRCm39) N91K probably damaging Het
Tmem132d T G 5: 127,941,710 (GRCm39) Q463H probably benign Het
Tmf1 A G 6: 97,153,102 (GRCm39) S324P probably damaging Het
Tnc T C 4: 63,918,396 (GRCm39) T1172A probably benign Het
Usp17lb A T 7: 104,489,746 (GRCm39) C393S probably benign Het
Usp42 G A 5: 143,700,616 (GRCm39) L1136F probably damaging Het
Vmn2r92 T G 17: 18,389,183 (GRCm39) M499R probably benign Het
Vps54 T A 11: 21,261,071 (GRCm39) probably benign Het
Wdr6 C T 9: 108,450,300 (GRCm39) R1076H probably benign Het
Wdr72 T A 9: 74,118,039 (GRCm39) M917K possibly damaging Het
Wee2 T C 6: 40,433,929 (GRCm39) V281A probably benign Het
Zc3h6 A G 2: 128,856,747 (GRCm39) D609G probably benign Het
Zfp345 G A 2: 150,315,163 (GRCm39) H125Y possibly damaging Het
Zhx2 A G 15: 57,685,236 (GRCm39) K202E probably damaging Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122,715,971 (GRCm39) nonsense probably null
IGL01607:Zic2 APN 14 122,716,294 (GRCm39) splice site probably benign
IGL02307:Zic2 APN 14 122,714,046 (GRCm39) missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122,713,606 (GRCm39) missense probably damaging 0.99
IGL02561:Zic2 APN 14 122,715,957 (GRCm39) nonsense probably null
IGL02982:Zic2 APN 14 122,715,979 (GRCm39) missense probably damaging 0.98
R0001:Zic2 UTSW 14 122,716,369 (GRCm39) missense probably damaging 0.99
R0027:Zic2 UTSW 14 122,713,755 (GRCm39) missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122,713,953 (GRCm39) missense probably damaging 0.96
R0310:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0418:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0421:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0518:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0520:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0521:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R0628:Zic2 UTSW 14 122,713,776 (GRCm39) small deletion probably benign
R1733:Zic2 UTSW 14 122,716,359 (GRCm39) missense probably damaging 0.97
R1757:Zic2 UTSW 14 122,716,031 (GRCm39) missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122,716,329 (GRCm39) nonsense probably null
R5323:Zic2 UTSW 14 122,713,728 (GRCm39) missense probably damaging 1.00
R5381:Zic2 UTSW 14 122,713,227 (GRCm39) missense probably damaging 0.97
R6930:Zic2 UTSW 14 122,713,869 (GRCm39) missense probably damaging 0.99
R7223:Zic2 UTSW 14 122,713,503 (GRCm39) missense probably damaging 0.98
R8750:Zic2 UTSW 14 122,714,129 (GRCm39) missense probably benign 0.06
R8852:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
R8860:Zic2 UTSW 14 122,713,530 (GRCm39) missense possibly damaging 0.92
Z1088:Zic2 UTSW 14 122,716,087 (GRCm39) missense probably damaging 0.98
Predicted Primers
Posted On 2013-08-19