Mutagenetix > Incidental Mutation

Incidental Mutation 'R8744:Itpr1'

663423

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R8744 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 108377802 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 457 (A457S)

Ref Sequence

ENSEMBL: ENSMUSP00000032192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000203936]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: A457S

PolyPhen 2 Score 0.793 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: A457S

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203615
AA Change: A457S

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: A457S

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000203936

SMART Domains

Protein: ENSMUSP00000145526
Gene: ENSMUSG00000030102

Domain	Start	End	E-Value	Type
MIR	5	61	1.3e-11	SMART
MIR	68	162	1.6e-13	SMART

Meta Mutation Damage Score

0.1329

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.4%

Validation Efficiency

98% (64/65)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930438A08Rik	C	A	11: 58,291,434		probably null	Het
Adam2	A	G	14: 66,034,716		probably null	Het
Akt2	A	T	7: 27,618,313	D94V	probably benign	Het
Anapc7	C	T	5: 122,428,148	S40L	probably benign	Het
Ash1l	G	T	3: 89,058,583	A2431S	possibly damaging	Het
Atoh1	A	T	6: 64,729,918	Q199L	probably damaging	Het
Atp10b	T	C	11: 43,230,350	C947R	probably damaging	Het
Ccdc50	G	A	16: 27,436,398	V199I	possibly damaging	Het
Ccne1	A	T	7: 38,103,173	C65S	probably benign	Het
Cep152	A	G	2: 125,594,871		probably null	Het
Col6a3	C	G	1: 90,767,606		probably benign	Het
Cyp4a10	A	G	4: 115,529,470	D438G	probably benign	Het
Dgkb	A	G	12: 38,438,612	H659R	probably damaging	Het
Dhx29	A	G	13: 112,952,884	I730V	possibly damaging	Het
Dync2h1	G	A	9: 7,011,220	Q3658*	probably null	Het
Eif2ak4	C	A	2: 118,430,993	C671*	probably null	Het
Eif4g3	AGCGGCGGCGGCGGCGGC	AGCGGCGGCGGCGGC	4: 137,994,061		probably benign	Het
Ep400	T	C	5: 110,742,059	H446R	unknown	Het
Epb41l2	C	T	10: 25,441,827	L81F	probably damaging	Het
Ercc8	G	A	13: 108,183,773	A298T	probably benign	Het
Fbxo10	T	C	4: 45,043,880	M648V	probably benign	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Gnpda2	C	T	5: 69,578,116	A211T	probably damaging	Het
Gtf2h5	C	CA	17: 6,084,558		probably null	Het
Hormad1	T	C	3: 95,562,615	Y58H	possibly damaging	Het
Igkv4-81	T	C	6: 68,991,062	I18M	possibly damaging	Het
Itgav	G	T	2: 83,770,083	A312S	probably benign	Het
Kcna10	T	C	3: 107,194,386	L111P	probably damaging	Het
Kcnh7	T	C	2: 63,182,089	R92G	possibly damaging	Het
Lamc2	G	A	1: 153,143,738	P486S	probably benign	Het
Lrba	C	T	3: 86,304,333	T420M	probably benign	Het
Lrrc52	G	A	1: 167,466,581	T45M	probably benign	Het
Lsm8	C	A	6: 18,853,639	A80E	probably benign	Het
Ly6g	T	A	15: 75,155,669	S9T	probably benign	Het
Mcc	A	G	18: 44,724,572	Y159H	probably benign	Het
Megf11	T	C	9: 64,544,688		probably null	Het
Mrpl9	T	A	3: 94,447,775		probably benign	Het
Ndst4	T	C	3: 125,713,340	F210L	possibly damaging	Het
Olfr1168	T	A	2: 88,185,379	C167*	probably null	Het
Olfr1402	A	G	3: 97,410,281	V300A	probably benign	Het
Pappa2	A	G	1: 158,783,917	V1492A	possibly damaging	Het
Pcdhga2	A	G	18: 37,671,320	H739R	probably benign	Het
Pcdhga8	A	G	18: 37,727,774	T628A	probably damaging	Het
Plekhn1	C	T	4: 156,233,907	R86H	probably damaging	Het
Pofut1	T	A	2: 153,259,541	W72R	probably benign	Het
Polr3b	C	A	10: 84,628,624		probably benign	Het
Rab3b	A	T	4: 108,923,987	I104F	probably damaging	Het
Rab5b	A	T	10: 128,682,882	V127D	probably damaging	Het
Rnf170	A	G	8: 26,129,380	M211V	unknown	Het
Rpl7	T	C	1: 16,101,889	T218A	probably benign	Het
Serinc2	T	C	4: 130,265,195		probably benign	Het
Socs2	T	A	10: 95,392,800	Q196L		Het
Stab2	T	C	10: 86,969,349	H255R	probably benign	Het
Syvn1	G	A	19: 6,049,168	G149D	probably damaging	Het
Them5	T	C	3: 94,346,165	S161P	probably damaging	Het
Tlr1	A	T	5: 64,926,530	Y235N	possibly damaging	Het
Toporsl	T	C	4: 52,611,967	L620P	probably benign	Het
Traf3	A	T	12: 111,261,796	E480D	probably benign	Het
Trav13n-4	A	G	14: 53,363,942	Y56C	probably damaging	Het
Trps1	T	C	15: 50,661,246	Y1096C	probably damaging	Het
Usp2	A	G	9: 44,087,213		probably benign	Het
Usp40	A	T	1: 87,983,769	L512Q	probably benign	Het
Vmn1r175	T	C	7: 23,808,978	T75A	probably benign	Het
Zan	A	G	5: 137,427,864	V2550A	unknown	Het
Zfp235	A	T	7: 24,140,499	E114D	possibly damaging	Het
Zmym1	A	T	4: 127,051,372	D141E	probably damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCACTGCCCAATATCCTG -3'
(R):5'- ACGGAGCTGCATAATACAACTG -3'

Sequencing Primer
(F):5'- CTGCCCAATATCCTGTAAAGAAAGTG -3'
(R):5'- GCTGCATAATACAACTGAAACAAAAC -3'

Posted On

2021-03-08