Mutagenetix > Incidental Mutation

Incidental Mutation 'R0421:Zic2'

66343

Institutional Source

Beutler Lab

Gene Symbol

Zic2

Ensembl Gene

ENSMUSG00000061524

Gene Name

zinc finger protein of the cerebellum 2

Synonyms

odd-paired homolog, GENA 29, Ku

MMRRC Submission

038623-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R0421 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

122712847-122717264 bp(+) (GRCm39)

Type of Mutation

small deletion (2 aa in frame mutation)

DNA Base Change (assembly)

CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122713776 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075888]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075888

SMART Domains

Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
low complexity region	81	103	N/A	INTRINSIC
low complexity region	131	150	N/A	INTRINSIC
low complexity region	215	241	N/A	INTRINSIC
ZnF_C2H2	265	290	5.68e1	SMART
ZnF_C2H2	299	326	6.92e0	SMART
ZnF_C2H2	332	356	8.02e-5	SMART
ZnF_C2H2	362	386	1.69e-3	SMART
ZnF_C2H2	392	414	4.54e-4	SMART
low complexity region	416	434	N/A	INTRINSIC
low complexity region	455	519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135485

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177306

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi1	G	A	2: 22,850,839 (GRCm39)	T195I	probably damaging	Het
Afap1l1	T	C	18: 61,884,945 (GRCm39)	N180S	probably damaging	Het
Arsg	A	G	11: 109,418,592 (GRCm39)	Y196C	probably damaging	Het
Ascc3	G	T	10: 50,625,022 (GRCm39)	V1637L	probably benign	Het
Atp2b2	C	A	6: 113,790,849 (GRCm39)	R185L	probably damaging	Het
Ccr9	A	T	9: 123,608,671 (GRCm39)	M118L	probably benign	Het
Cdh12	A	T	15: 21,480,310 (GRCm39)		probably null	Het
Cdk13	T	C	13: 17,937,755 (GRCm39)	S763G	probably damaging	Het
Cenpk	C	A	13: 104,378,911 (GRCm39)	N177K	probably benign	Het
Cfap43	T	G	19: 47,824,014 (GRCm39)	N119T	probably benign	Het
Chrna6	T	C	8: 27,898,415 (GRCm39)	E101G	probably null	Het
Clasp2	G	A	9: 113,683,370 (GRCm39)	R400H	probably benign	Het
Col6a6	T	C	9: 105,661,405 (GRCm39)	M235V	probably benign	Het
Ddx49	A	T	8: 70,748,282 (GRCm39)	L291Q	probably damaging	Het
Dhrs7	A	T	12: 72,699,860 (GRCm39)		probably benign	Het
Dnah5	A	T	15: 28,229,687 (GRCm39)	K107M	possibly damaging	Het
Dsg2	C	T	18: 20,712,448 (GRCm39)	R151C	probably damaging	Het
Dsn1	T	C	2: 156,847,789 (GRCm39)	T2A	possibly damaging	Het
Edem3	A	G	1: 151,668,189 (GRCm39)		probably benign	Het
Eif3c	T	C	7: 126,162,884 (GRCm39)	N133S	possibly damaging	Het
F10	A	G	8: 13,095,097 (GRCm39)	K85E	probably benign	Het
Fbn2	T	A	18: 58,160,876 (GRCm39)		probably benign	Het
Gtpbp10	A	T	5: 5,607,290 (GRCm39)	H50Q	probably benign	Het
Hephl1	A	G	9: 14,970,456 (GRCm39)	F1013L	probably benign	Het
Hps3	C	A	3: 20,083,480 (GRCm39)	V238F	probably benign	Het
Kcna10	A	C	3: 107,101,820 (GRCm39)	K150N	probably damaging	Het
Kirrel1	C	T	3: 86,990,914 (GRCm39)	G636D	probably damaging	Het
Kndc1	G	A	7: 139,488,912 (GRCm39)	R189H	probably damaging	Het
Knop1	C	T	7: 118,454,852 (GRCm39)	E50K	possibly damaging	Het
Kplce	T	C	3: 92,776,291 (GRCm39)	T131A	probably damaging	Het
Kpna7	T	A	5: 144,926,551 (GRCm39)	H467L	possibly damaging	Het
Lcn4	T	C	2: 26,558,661 (GRCm39)	N142D	possibly damaging	Het
Map3k3	T	C	11: 106,039,741 (GRCm39)		probably benign	Het
Mdn1	A	G	4: 32,684,707 (GRCm39)	T806A	probably benign	Het
Nbeal1	T	A	1: 60,307,598 (GRCm39)	N1703K	probably benign	Het
Neurl4	T	C	11: 69,799,360 (GRCm39)	V914A	probably damaging	Het
Niban1	T	A	1: 151,584,833 (GRCm39)		probably benign	Het
Nop56	T	C	2: 130,118,692 (GRCm39)	S275P	possibly damaging	Het
Or1j20	A	G	2: 36,759,653 (GRCm39)	E25G	possibly damaging	Het
Or52ac1	A	G	7: 104,245,929 (GRCm39)	V153A	probably benign	Het
Or7e174	A	G	9: 20,012,771 (GRCm39)	K239E	probably damaging	Het
Otof	A	C	5: 30,528,912 (GRCm39)	I1827S	possibly damaging	Het
Pappa2	A	T	1: 158,675,650 (GRCm39)	I1032N	probably damaging	Het
Pcdh7	A	G	5: 57,877,402 (GRCm39)	E319G	probably damaging	Het
Pcdhb11	T	A	18: 37,555,533 (GRCm39)	S288T	probably benign	Het
Phip	A	T	9: 82,808,510 (GRCm39)	D488E	probably damaging	Het
Pla2g7	A	T	17: 43,922,303 (GRCm39)	H394L	probably damaging	Het
Plk3	A	G	4: 116,990,641 (GRCm39)	V69A	probably damaging	Het
Prob1	C	A	18: 35,786,083 (GRCm39)	A724S	possibly damaging	Het
Prune2	T	C	19: 17,100,675 (GRCm39)	F2060L	probably benign	Het
Rgl3	G	A	9: 21,887,328 (GRCm39)	R498C	probably benign	Het
Rnf213	A	C	11: 119,338,083 (GRCm39)	N3362H	probably damaging	Het
Sbds	A	G	5: 130,282,774 (GRCm39)		probably benign	Het
Scn9a	T	C	2: 66,373,621 (GRCm39)	S453G	probably benign	Het
Sh3rf3	T	C	10: 58,819,897 (GRCm39)	L236P	probably damaging	Het
Skint1	A	G	4: 111,876,211 (GRCm39)	N44S	possibly damaging	Het
Slc5a1	T	A	5: 33,291,996 (GRCm39)	I141N	probably damaging	Het
Tlcd3b	G	A	7: 126,424,187 (GRCm39)	V44M	probably damaging	Het
Trank1	T	A	9: 111,220,907 (GRCm39)	I2548N	probably damaging	Het
Tsc22d2	G	A	3: 58,324,749 (GRCm39)		probably benign	Het
Unc13c	T	A	9: 73,840,492 (GRCm39)	I120F	possibly damaging	Het
Vmn2r11	T	G	5: 109,207,294 (GRCm39)	I9L	probably benign	Het
Vmn2r58	T	G	7: 41,514,628 (GRCm39)	N114H	probably benign	Het
Vps53	A	G	11: 75,973,496 (GRCm39)	L166P	probably damaging	Het
Zfp119a	T	A	17: 56,172,248 (GRCm39)	K532*	probably null	Het
Zfp472	A	G	17: 33,194,897 (GRCm39)	T11A	possibly damaging	Het
Zfp512b	T	A	2: 181,230,051 (GRCm39)	K87*	probably null	Het
Zfp518b	G	A	5: 38,831,918 (GRCm39)	P29L	probably damaging	Het
Zfp599	A	G	9: 22,161,843 (GRCm39)		probably benign	Het

Other mutations in Zic2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00816:Zic2	APN	14	122,715,971 (GRCm39)	nonsense	probably null
IGL01607:Zic2	APN	14	122,716,294 (GRCm39)	splice site	probably benign
IGL02307:Zic2	APN	14	122,714,046 (GRCm39)	missense	possibly damaging	0.76
IGL02311:Zic2	APN	14	122,713,606 (GRCm39)	missense	probably damaging	0.99
IGL02561:Zic2	APN	14	122,715,957 (GRCm39)	nonsense	probably null
IGL02982:Zic2	APN	14	122,715,979 (GRCm39)	missense	probably damaging	0.98
R0001:Zic2	UTSW	14	122,716,369 (GRCm39)	missense	probably damaging	0.99
R0027:Zic2	UTSW	14	122,713,755 (GRCm39)	missense	possibly damaging	0.77
R0136:Zic2	UTSW	14	122,713,953 (GRCm39)	missense	probably damaging	0.96
R0310:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0418:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0420:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0518:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0520:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0521:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R0628:Zic2	UTSW	14	122,713,776 (GRCm39)	small deletion	probably benign
R1733:Zic2	UTSW	14	122,716,359 (GRCm39)	missense	probably damaging	0.97
R1757:Zic2	UTSW	14	122,716,031 (GRCm39)	missense	possibly damaging	0.86
R2398:Zic2	UTSW	14	122,716,329 (GRCm39)	nonsense	probably null
R5323:Zic2	UTSW	14	122,713,728 (GRCm39)	missense	probably damaging	1.00
R5381:Zic2	UTSW	14	122,713,227 (GRCm39)	missense	probably damaging	0.97
R6930:Zic2	UTSW	14	122,713,869 (GRCm39)	missense	probably damaging	0.99
R7223:Zic2	UTSW	14	122,713,503 (GRCm39)	missense	probably damaging	0.98
R8750:Zic2	UTSW	14	122,714,129 (GRCm39)	missense	probably benign	0.06
R8852:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
R8860:Zic2	UTSW	14	122,713,530 (GRCm39)	missense	possibly damaging	0.92
Z1088:Zic2	UTSW	14	122,716,087 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

Posted On

2013-08-19