Incidental Mutation 'R8744:Stab2'
ID 663432
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms FEEL-2, STAB-2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8744 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86677062-86843889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86805213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 255 (H255R)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: H255R

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: H255R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,182,260 (GRCm39) probably null Het
Adam2 A G 14: 66,272,165 (GRCm39) probably null Het
Akt2 A T 7: 27,317,738 (GRCm39) D94V probably benign Het
Anapc7 C T 5: 122,566,211 (GRCm39) S40L probably benign Het
Ash1l G T 3: 88,965,890 (GRCm39) A2431S possibly damaging Het
Atoh1 A T 6: 64,706,902 (GRCm39) Q199L probably damaging Het
Atp10b T C 11: 43,121,177 (GRCm39) C947R probably damaging Het
Ccdc50 G A 16: 27,255,148 (GRCm39) V199I possibly damaging Het
Ccne1 A T 7: 37,802,598 (GRCm39) C65S probably benign Het
Cep152 A G 2: 125,436,791 (GRCm39) probably null Het
Col6a3 C G 1: 90,695,328 (GRCm39) probably benign Het
Cyp4a10 A G 4: 115,386,667 (GRCm39) D438G probably benign Het
Dgkb A G 12: 38,488,611 (GRCm39) H659R probably damaging Het
Dhx29 A G 13: 113,089,418 (GRCm39) I730V possibly damaging Het
Dync2h1 G A 9: 7,011,220 (GRCm39) Q3658* probably null Het
Eif2ak4 C A 2: 118,261,474 (GRCm39) C671* probably null Het
Eif4g3 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 4: 137,721,372 (GRCm39) probably benign Het
Ep400 T C 5: 110,889,925 (GRCm39) H446R unknown Het
Epb41l2 C T 10: 25,317,725 (GRCm39) L81F probably damaging Het
Ercc8 G A 13: 108,320,307 (GRCm39) A298T probably benign Het
Fbxo10 T C 4: 45,043,880 (GRCm39) M648V probably benign Het
G530012D18Rik C G 1: 85,504,935 (GRCm39) D113E unknown Het
Gnpda2 C T 5: 69,735,459 (GRCm39) A211T probably damaging Het
Gtf2h5 C CA 17: 6,134,833 (GRCm39) probably null Het
Hormad1 T C 3: 95,469,926 (GRCm39) Y58H possibly damaging Het
Igkv4-81 T C 6: 68,968,046 (GRCm39) I18M possibly damaging Het
Itgav G T 2: 83,600,427 (GRCm39) A312S probably benign Het
Itpr1 G T 6: 108,354,763 (GRCm39) A457S possibly damaging Het
Kcna10 T C 3: 107,101,702 (GRCm39) L111P probably damaging Het
Kcnh7 T C 2: 63,012,433 (GRCm39) R92G possibly damaging Het
Lamc2 G A 1: 153,019,484 (GRCm39) P486S probably benign Het
Lrba C T 3: 86,211,640 (GRCm39) T420M probably benign Het
Lrrc52 G A 1: 167,294,150 (GRCm39) T45M probably benign Het
Lsm8 C A 6: 18,853,638 (GRCm39) A80E probably benign Het
Ly6g T A 15: 75,027,518 (GRCm39) S9T probably benign Het
Mcc A G 18: 44,857,639 (GRCm39) Y159H probably benign Het
Megf11 T C 9: 64,451,970 (GRCm39) probably null Het
Mrpl9 T A 3: 94,355,082 (GRCm39) probably benign Het
Ndst4 T C 3: 125,506,989 (GRCm39) F210L possibly damaging Het
Or13l2 A G 3: 97,317,597 (GRCm39) V300A probably benign Het
Or5d40 T A 2: 88,015,723 (GRCm39) C167* probably null Het
Pappa2 A G 1: 158,611,487 (GRCm39) V1492A possibly damaging Het
Pcdhga2 A G 18: 37,804,373 (GRCm39) H739R probably benign Het
Pcdhga8 A G 18: 37,860,827 (GRCm39) T628A probably damaging Het
Plekhn1 C T 4: 156,318,364 (GRCm39) R86H probably damaging Het
Pofut1 T A 2: 153,101,461 (GRCm39) W72R probably benign Het
Polr3b C A 10: 84,464,488 (GRCm39) probably benign Het
Rab3b A T 4: 108,781,184 (GRCm39) I104F probably damaging Het
Rab5b A T 10: 128,518,751 (GRCm39) V127D probably damaging Het
Rnf170 A G 8: 26,619,408 (GRCm39) M211V unknown Het
Rpl7 T C 1: 16,172,113 (GRCm39) T218A probably benign Het
Serinc2 T C 4: 130,158,988 (GRCm39) probably benign Het
Socs2 T A 10: 95,228,662 (GRCm39) Q196L Het
Syvn1 G A 19: 6,099,198 (GRCm39) G149D probably damaging Het
Them5 T C 3: 94,253,472 (GRCm39) S161P probably damaging Het
Tlr1 A T 5: 65,083,873 (GRCm39) Y235N possibly damaging Het
Toporsl T C 4: 52,611,967 (GRCm39) L620P probably benign Het
Traf3 A T 12: 111,228,230 (GRCm39) E480D probably benign Het
Trav13n-4 A G 14: 53,601,399 (GRCm39) Y56C probably damaging Het
Trps1 T C 15: 50,524,642 (GRCm39) Y1096C probably damaging Het
Usp2 A G 9: 43,998,510 (GRCm39) probably benign Het
Usp40 A T 1: 87,911,491 (GRCm39) L512Q probably benign Het
Vmn1r175 T C 7: 23,508,403 (GRCm39) T75A probably benign Het
Zan A G 5: 137,426,126 (GRCm39) V2550A unknown Het
Zfp235 A T 7: 23,839,924 (GRCm39) E114D possibly damaging Het
Zmym1 A T 4: 126,945,165 (GRCm39) D141E probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86,705,070 (GRCm39) splice site probably null
IGL00809:Stab2 APN 10 86,684,038 (GRCm39) splice site probably benign
IGL00911:Stab2 APN 10 86,805,617 (GRCm39) missense probably damaging 1.00
IGL01347:Stab2 APN 10 86,737,567 (GRCm39) splice site probably null
IGL01411:Stab2 APN 10 86,815,872 (GRCm39) splice site probably benign
IGL01503:Stab2 APN 10 86,776,477 (GRCm39) splice site probably benign
IGL01599:Stab2 APN 10 86,758,759 (GRCm39) missense probably damaging 1.00
IGL01635:Stab2 APN 10 86,816,992 (GRCm39) missense probably benign 0.04
IGL01640:Stab2 APN 10 86,790,035 (GRCm39) missense probably benign 0.09
IGL01671:Stab2 APN 10 86,805,141 (GRCm39) missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86,707,695 (GRCm39) missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86,803,514 (GRCm39) missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86,695,606 (GRCm39) splice site probably null
IGL02600:Stab2 APN 10 86,790,123 (GRCm39) missense probably damaging 1.00
IGL02666:Stab2 APN 10 86,686,766 (GRCm39) missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86,682,027 (GRCm39) splice site probably benign
IGL02709:Stab2 APN 10 86,682,029 (GRCm39) splice site probably benign
IGL02728:Stab2 APN 10 86,692,420 (GRCm39) missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86,786,133 (GRCm39) splice site probably benign
IGL02938:Stab2 APN 10 86,707,785 (GRCm39) missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86,832,667 (GRCm39) critical splice donor site probably null
IGL03238:Stab2 APN 10 86,690,985 (GRCm39) missense probably damaging 1.00
IGL03402:Stab2 APN 10 86,805,165 (GRCm39) missense probably benign 0.03
prospector UTSW 10 86,737,431 (GRCm39) splice site probably null
songbird UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
3-1:Stab2 UTSW 10 86,705,041 (GRCm39) missense probably damaging 0.96
F6893:Stab2 UTSW 10 86,691,035 (GRCm39) missense probably damaging 1.00
K7371:Stab2 UTSW 10 86,779,153 (GRCm39) critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86,703,039 (GRCm39) missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86,697,299 (GRCm39) nonsense probably null
R0015:Stab2 UTSW 10 86,679,481 (GRCm39) missense probably benign
R0254:Stab2 UTSW 10 86,733,824 (GRCm39) missense probably benign
R0310:Stab2 UTSW 10 86,803,477 (GRCm39) splice site probably benign
R0333:Stab2 UTSW 10 86,677,491 (GRCm39) missense probably benign
R0391:Stab2 UTSW 10 86,783,008 (GRCm39) missense probably benign 0.27
R0400:Stab2 UTSW 10 86,708,474 (GRCm39) missense probably damaging 1.00
R0433:Stab2 UTSW 10 86,679,355 (GRCm39) splice site probably benign
R0440:Stab2 UTSW 10 86,785,792 (GRCm39) missense probably benign 0.23
R0743:Stab2 UTSW 10 86,723,759 (GRCm39) missense probably damaging 1.00
R0847:Stab2 UTSW 10 86,805,735 (GRCm39) missense probably benign 0.00
R0883:Stab2 UTSW 10 86,760,314 (GRCm39) splice site probably benign
R1078:Stab2 UTSW 10 86,742,997 (GRCm39) splice site probably null
R1118:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1119:Stab2 UTSW 10 86,695,619 (GRCm39) missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86,786,165 (GRCm39) missense probably damaging 0.98
R1440:Stab2 UTSW 10 86,697,231 (GRCm39) splice site probably null
R1550:Stab2 UTSW 10 86,714,790 (GRCm39) missense probably benign 0.01
R1616:Stab2 UTSW 10 86,721,582 (GRCm39) splice site probably null
R1728:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1768:Stab2 UTSW 10 86,838,872 (GRCm39) missense probably damaging 1.00
R1772:Stab2 UTSW 10 86,790,098 (GRCm39) missense probably benign 0.06
R1776:Stab2 UTSW 10 86,793,680 (GRCm39) missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86,773,903 (GRCm39) missense probably benign 0.41
R1892:Stab2 UTSW 10 86,773,913 (GRCm39) missense probably damaging 0.99
R1957:Stab2 UTSW 10 86,697,334 (GRCm39) missense probably benign 0.13
R1972:Stab2 UTSW 10 86,796,180 (GRCm39) missense probably damaging 0.99
R1975:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1976:Stab2 UTSW 10 86,732,360 (GRCm39) critical splice donor site probably null
R1996:Stab2 UTSW 10 86,838,895 (GRCm39) missense probably damaging 1.00
R2085:Stab2 UTSW 10 86,790,023 (GRCm39) missense probably damaging 1.00
R2149:Stab2 UTSW 10 86,700,904 (GRCm39) nonsense probably null
R2169:Stab2 UTSW 10 86,723,726 (GRCm39) missense probably damaging 1.00
R2201:Stab2 UTSW 10 86,776,503 (GRCm39) missense probably benign 0.22
R2296:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86,790,338 (GRCm39) critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86,805,183 (GRCm39) missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86,770,704 (GRCm39) splice site probably benign
R2696:Stab2 UTSW 10 86,697,363 (GRCm39) missense probably benign 0.45
R2883:Stab2 UTSW 10 86,803,550 (GRCm39) missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86,697,325 (GRCm39) missense probably damaging 1.00
R3711:Stab2 UTSW 10 86,702,572 (GRCm39) missense probably damaging 1.00
R3787:Stab2 UTSW 10 86,805,141 (GRCm39) missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86,785,776 (GRCm39) missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86,714,750 (GRCm39) missense probably damaging 0.97
R3979:Stab2 UTSW 10 86,699,320 (GRCm39) missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86,693,988 (GRCm39) missense probably damaging 1.00
R4088:Stab2 UTSW 10 86,758,049 (GRCm39) missense probably damaging 1.00
R4151:Stab2 UTSW 10 86,838,847 (GRCm39) missense probably benign 0.12
R4190:Stab2 UTSW 10 86,714,808 (GRCm39) missense probably damaging 0.98
R4556:Stab2 UTSW 10 86,803,543 (GRCm39) missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86,743,235 (GRCm39) nonsense probably null
R4825:Stab2 UTSW 10 86,783,011 (GRCm39) missense probably benign 0.08
R4865:Stab2 UTSW 10 86,679,364 (GRCm39) splice site probably null
R4871:Stab2 UTSW 10 86,778,099 (GRCm39) missense probably damaging 0.99
R4943:Stab2 UTSW 10 86,790,026 (GRCm39) missense probably damaging 0.99
R4981:Stab2 UTSW 10 86,796,087 (GRCm39) missense probably benign
R4994:Stab2 UTSW 10 86,785,771 (GRCm39) missense probably benign
R4999:Stab2 UTSW 10 86,773,773 (GRCm39) missense probably damaging 0.97
R5061:Stab2 UTSW 10 86,743,249 (GRCm39) missense probably damaging 1.00
R5072:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5073:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5074:Stab2 UTSW 10 86,699,422 (GRCm39) missense probably benign 0.23
R5134:Stab2 UTSW 10 86,707,674 (GRCm39) splice site probably null
R5213:Stab2 UTSW 10 86,743,061 (GRCm39) missense probably damaging 0.99
R5508:Stab2 UTSW 10 86,796,143 (GRCm39) missense probably benign 0.01
R5530:Stab2 UTSW 10 86,783,026 (GRCm39) missense probably benign 0.04
R5540:Stab2 UTSW 10 86,683,989 (GRCm39) missense probably benign 0.30
R5839:Stab2 UTSW 10 86,708,555 (GRCm39) missense probably damaging 0.97
R5949:Stab2 UTSW 10 86,805,713 (GRCm39) missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86,773,906 (GRCm39) missense probably damaging 0.99
R6019:Stab2 UTSW 10 86,838,886 (GRCm39) missense probably benign 0.00
R6116:Stab2 UTSW 10 86,743,054 (GRCm39) missense probably damaging 1.00
R6131:Stab2 UTSW 10 86,719,642 (GRCm39) splice site probably null
R6209:Stab2 UTSW 10 86,758,867 (GRCm39) missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86,743,025 (GRCm39) missense probably damaging 1.00
R6433:Stab2 UTSW 10 86,737,431 (GRCm39) splice site probably null
R6787:Stab2 UTSW 10 86,754,948 (GRCm39) missense probably benign 0.07
R6841:Stab2 UTSW 10 86,778,054 (GRCm39) missense probably damaging 1.00
R6873:Stab2 UTSW 10 86,697,230 (GRCm39) critical splice donor site probably null
R7025:Stab2 UTSW 10 86,686,701 (GRCm39) missense probably damaging 1.00
R7043:Stab2 UTSW 10 86,706,110 (GRCm39) missense probably damaging 0.99
R7047:Stab2 UTSW 10 86,694,016 (GRCm39) missense probably damaging 1.00
R7107:Stab2 UTSW 10 86,741,456 (GRCm39) missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86,735,705 (GRCm39) missense probably damaging 0.99
R7271:Stab2 UTSW 10 86,838,972 (GRCm39) splice site probably null
R7291:Stab2 UTSW 10 86,782,084 (GRCm39) missense probably damaging 0.96
R7336:Stab2 UTSW 10 86,805,049 (GRCm39) nonsense probably null
R7432:Stab2 UTSW 10 86,721,547 (GRCm39) missense probably damaging 0.99
R7580:Stab2 UTSW 10 86,705,028 (GRCm39) missense probably benign 0.00
R7622:Stab2 UTSW 10 86,709,766 (GRCm39) missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86,719,646 (GRCm39) critical splice donor site probably null
R7658:Stab2 UTSW 10 86,816,999 (GRCm39) missense probably benign 0.12
R7798:Stab2 UTSW 10 86,793,776 (GRCm39) missense probably damaging 0.98
R7835:Stab2 UTSW 10 86,708,483 (GRCm39) missense probably benign 0.06
R7845:Stab2 UTSW 10 86,832,758 (GRCm39) missense probably benign 0.09
R7863:Stab2 UTSW 10 86,808,745 (GRCm39) missense probably benign 0.30
R7885:Stab2 UTSW 10 86,714,776 (GRCm39) missense probably benign 0.03
R7904:Stab2 UTSW 10 86,790,056 (GRCm39) nonsense probably null
R7947:Stab2 UTSW 10 86,681,897 (GRCm39) missense probably benign 0.31
R7963:Stab2 UTSW 10 86,683,887 (GRCm39) critical splice donor site probably null
R8014:Stab2 UTSW 10 86,686,767 (GRCm39) missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86,741,403 (GRCm39) missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86,681,916 (GRCm39) missense probably benign 0.34
R8097:Stab2 UTSW 10 86,704,959 (GRCm39) missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86,709,728 (GRCm39) missense probably damaging 0.98
R8462:Stab2 UTSW 10 86,803,598 (GRCm39) missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86,776,587 (GRCm39) missense probably damaging 1.00
R8692:Stab2 UTSW 10 86,808,794 (GRCm39) missense probably damaging 0.99
R8745:Stab2 UTSW 10 86,805,213 (GRCm39) missense probably benign 0.32
R8782:Stab2 UTSW 10 86,735,685 (GRCm39) missense probably benign 0.00
R8875:Stab2 UTSW 10 86,832,728 (GRCm39) missense probably damaging 1.00
R8978:Stab2 UTSW 10 86,785,782 (GRCm39) missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9248:Stab2 UTSW 10 86,727,481 (GRCm39) missense probably damaging 0.98
R9326:Stab2 UTSW 10 86,791,010 (GRCm39) missense probably damaging 1.00
R9426:Stab2 UTSW 10 86,704,911 (GRCm39) missense probably damaging 1.00
R9568:Stab2 UTSW 10 86,699,420 (GRCm39) missense probably damaging 1.00
R9627:Stab2 UTSW 10 86,793,704 (GRCm39) missense probably damaging 0.98
R9635:Stab2 UTSW 10 86,686,651 (GRCm39) nonsense probably null
R9648:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9649:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9650:Stab2 UTSW 10 86,692,561 (GRCm39) frame shift probably null
R9726:Stab2 UTSW 10 86,790,095 (GRCm39) missense probably benign 0.00
R9756:Stab2 UTSW 10 86,803,553 (GRCm39) missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86,757,997 (GRCm39) missense probably benign 0.03
RF061:Stab2 UTSW 10 86,702,622 (GRCm39) critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86,758,062 (GRCm39) critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86,723,680 (GRCm39) missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86,785,778 (GRCm39) missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86,732,460 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCACTTGAACGCTTTTCC -3'
(R):5'- AATGCTACTGCCTTTGTGCCTG -3'

Sequencing Primer
(F):5'- GATACACTAGCTCCATGCAGTCTTAG -3'
(R):5'- CCTGTGATGCATGTGAGTCATAG -3'
Posted On 2021-03-08