Incidental Mutation 'R8744:Trps1'
ID663443
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8744 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50661246 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1096 (Y1096C)
Ref Sequence ENSEMBL: ENSMUSP00000139017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably damaging
Transcript: ENSMUST00000077935
AA Change: Y1092C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: Y1092C

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165201
AA Change: Y1092C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: Y1092C

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183757
AA Change: Y1096C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: Y1096C

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183997
AA Change: Y907C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: Y907C

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184458
AA Change: Y805C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: Y805C

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184885
AA Change: Y846C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: Y846C

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
Adam2 A G 14: 66,034,716 probably null Het
Akt2 A T 7: 27,618,313 D94V probably benign Het
Anapc7 C T 5: 122,428,148 S40L probably benign Het
Ash1l G T 3: 89,058,583 A2431S possibly damaging Het
Atoh1 A T 6: 64,729,918 Q199L probably damaging Het
Atp10b T C 11: 43,230,350 C947R probably damaging Het
Ccdc50 G A 16: 27,436,398 V199I possibly damaging Het
Ccne1 A T 7: 38,103,173 C65S probably benign Het
Cep152 A G 2: 125,594,871 probably null Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cyp4a10 A G 4: 115,529,470 D438G probably benign Het
Dgkb A G 12: 38,438,612 H659R probably damaging Het
Dhx29 A G 13: 112,952,884 I730V possibly damaging Het
Dync2h1 G A 9: 7,011,220 Q3658* probably null Het
Eif2ak4 C A 2: 118,430,993 C671* probably null Het
Eif4g3 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 4: 137,994,061 probably benign Het
Ep400 T C 5: 110,742,059 H446R unknown Het
Epb41l2 C T 10: 25,441,827 L81F probably damaging Het
Ercc8 G A 13: 108,183,773 A298T probably benign Het
Fbxo10 T C 4: 45,043,880 M648V probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gnpda2 C T 5: 69,578,116 A211T probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hormad1 T C 3: 95,562,615 Y58H possibly damaging Het
Igkv4-81 T C 6: 68,991,062 I18M possibly damaging Het
Itgav G T 2: 83,770,083 A312S probably benign Het
Itpr1 G T 6: 108,377,802 A457S possibly damaging Het
Kcna10 T C 3: 107,194,386 L111P probably damaging Het
Kcnh7 T C 2: 63,182,089 R92G possibly damaging Het
Lamc2 G A 1: 153,143,738 P486S probably benign Het
Lrba C T 3: 86,304,333 T420M probably benign Het
Lrrc52 G A 1: 167,466,581 T45M probably benign Het
Lsm8 C A 6: 18,853,639 A80E probably benign Het
Ly6g T A 15: 75,155,669 S9T probably benign Het
Mcc A G 18: 44,724,572 Y159H probably benign Het
Megf11 T C 9: 64,544,688 probably null Het
Ndst4 T C 3: 125,713,340 F210L possibly damaging Het
Olfr1168 T A 2: 88,185,379 C167* probably null Het
Olfr1402 A G 3: 97,410,281 V300A probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pcdhga2 A G 18: 37,671,320 H739R probably benign Het
Pcdhga8 A G 18: 37,727,774 T628A probably damaging Het
Plekhn1 C T 4: 156,233,907 R86H probably damaging Het
Pofut1 T A 2: 153,259,541 W72R probably benign Het
Rab3b A T 4: 108,923,987 I104F probably damaging Het
Rab5b A T 10: 128,682,882 V127D probably damaging Het
Rnf170 A G 8: 26,129,380 M211V unknown Het
Rpl7 T C 1: 16,101,889 T218A probably benign Het
Serinc2 T C 4: 130,265,195 probably benign Het
Socs2 T A 10: 95,392,800 Q196L Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Syvn1 G A 19: 6,049,168 G149D probably damaging Het
Them5 T C 3: 94,346,165 S161P probably damaging Het
Tlr1 A T 5: 64,926,530 Y235N possibly damaging Het
Toporsl T C 4: 52,611,967 L620P probably benign Het
Traf3 A T 12: 111,261,796 E480D probably benign Het
Trav13n-4 A G 14: 53,363,942 Y56C probably damaging Het
Usp40 A T 1: 87,983,769 L512Q probably benign Het
Vmn1r175 T C 7: 23,808,978 T75A probably benign Het
Zan A G 5: 137,427,864 V2550A unknown Het
Zfp235 A T 7: 24,140,499 E114D possibly damaging Het
Zmym1 A T 4: 127,051,372 D141E probably damaging Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0377:Trps1 UTSW 15 50831778 nonsense probably null
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7986:Trps1 UTSW 15 50661736 missense probably damaging 1.00
R7986:Trps1 UTSW 15 50889623 missense probably benign 0.00
R8838:Trps1 UTSW 15 50889611 missense probably benign 0.01
R8859:Trps1 UTSW 15 50822373 missense possibly damaging 0.77
R8935:Trps1 UTSW 15 50888948 nonsense probably null
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGATCCAACAGCTGAG -3'
(R):5'- AGCTCTGGATATCCACAAAAGG -3'

Sequencing Primer
(F):5'- TGTCTGATCCAACAGCTGAGAAATG -3'
(R):5'- TCCACAAAAGGATGCAGCC -3'
Posted On2021-03-08