Incidental Mutation 'R8744:Ccdc50'
ID663445
Institutional Source Beutler Lab
Gene Symbol Ccdc50
Ensembl Gene ENSMUSG00000038127
Gene Namecoiled-coil domain containing 50
SynonymsD16Bwg1543e, 5730448P06Rik, 2610529H08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8744 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location27388869-27452218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27436398 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 199 (V199I)
Ref Sequence ENSEMBL: ENSMUSP00000097604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039443] [ENSMUST00000096127] [ENSMUST00000100026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039443
AA Change: V199I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038509
Gene: ENSMUSG00000038127
AA Change: V199I

DomainStartEndE-ValueType
Pfam:CCDC50_N 1 131 2e-59 PFAM
low complexity region 211 225 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096127
SMART Domains Protein: ENSMUSP00000093841
Gene: ENSMUSG00000038127

DomainStartEndE-ValueType
Pfam:CCDC50_N 1 131 1.8e-59 PFAM
coiled coil region 183 212 N/A INTRINSIC
low complexity region 223 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100026
AA Change: V199I

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097604
Gene: ENSMUSG00000038127
AA Change: V199I

DomainStartEndE-ValueType
Pfam:CCDC50_N 4 128 1.5e-50 PFAM
low complexity region 211 225 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000118633
Gene: ENSMUSG00000038127
AA Change: V200I

DomainStartEndE-ValueType
Pfam:CCDC50_N 16 130 4.7e-44 PFAM
low complexity region 213 227 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik C A 11: 58,291,434 probably null Het
Adam2 A G 14: 66,034,716 probably null Het
Akt2 A T 7: 27,618,313 D94V probably benign Het
Anapc7 C T 5: 122,428,148 S40L probably benign Het
Ash1l G T 3: 89,058,583 A2431S possibly damaging Het
Atoh1 A T 6: 64,729,918 Q199L probably damaging Het
Atp10b T C 11: 43,230,350 C947R probably damaging Het
Ccne1 A T 7: 38,103,173 C65S probably benign Het
Cep152 A G 2: 125,594,871 probably null Het
Col6a3 C G 1: 90,767,606 probably benign Het
Cyp4a10 A G 4: 115,529,470 D438G probably benign Het
Dgkb A G 12: 38,438,612 H659R probably damaging Het
Dhx29 A G 13: 112,952,884 I730V possibly damaging Het
Dync2h1 G A 9: 7,011,220 Q3658* probably null Het
Eif2ak4 C A 2: 118,430,993 C671* probably null Het
Eif4g3 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 4: 137,994,061 probably benign Het
Ep400 T C 5: 110,742,059 H446R unknown Het
Epb41l2 C T 10: 25,441,827 L81F probably damaging Het
Ercc8 G A 13: 108,183,773 A298T probably benign Het
Fbxo10 T C 4: 45,043,880 M648V probably benign Het
G530012D18Rik C G 1: 85,577,214 D113E unknown Het
Gnpda2 C T 5: 69,578,116 A211T probably damaging Het
Gtf2h5 C CA 17: 6,084,558 probably null Het
Hormad1 T C 3: 95,562,615 Y58H possibly damaging Het
Igkv4-81 T C 6: 68,991,062 I18M possibly damaging Het
Itgav G T 2: 83,770,083 A312S probably benign Het
Itpr1 G T 6: 108,377,802 A457S possibly damaging Het
Kcna10 T C 3: 107,194,386 L111P probably damaging Het
Kcnh7 T C 2: 63,182,089 R92G possibly damaging Het
Lamc2 G A 1: 153,143,738 P486S probably benign Het
Lrba C T 3: 86,304,333 T420M probably benign Het
Lrrc52 G A 1: 167,466,581 T45M probably benign Het
Lsm8 C A 6: 18,853,639 A80E probably benign Het
Ly6g T A 15: 75,155,669 S9T probably benign Het
Mcc A G 18: 44,724,572 Y159H probably benign Het
Megf11 T C 9: 64,544,688 probably null Het
Ndst4 T C 3: 125,713,340 F210L possibly damaging Het
Olfr1168 T A 2: 88,185,379 C167* probably null Het
Olfr1402 A G 3: 97,410,281 V300A probably benign Het
Pappa2 A G 1: 158,783,917 V1492A possibly damaging Het
Pcdhga2 A G 18: 37,671,320 H739R probably benign Het
Pcdhga8 A G 18: 37,727,774 T628A probably damaging Het
Plekhn1 C T 4: 156,233,907 R86H probably damaging Het
Pofut1 T A 2: 153,259,541 W72R probably benign Het
Rab3b A T 4: 108,923,987 I104F probably damaging Het
Rab5b A T 10: 128,682,882 V127D probably damaging Het
Rnf170 A G 8: 26,129,380 M211V unknown Het
Rpl7 T C 1: 16,101,889 T218A probably benign Het
Serinc2 T C 4: 130,265,195 probably benign Het
Socs2 T A 10: 95,392,800 Q196L Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Syvn1 G A 19: 6,049,168 G149D probably damaging Het
Them5 T C 3: 94,346,165 S161P probably damaging Het
Tlr1 A T 5: 64,926,530 Y235N possibly damaging Het
Toporsl T C 4: 52,611,967 L620P probably benign Het
Traf3 A T 12: 111,261,796 E480D probably benign Het
Trav13n-4 A G 14: 53,363,942 Y56C probably damaging Het
Trps1 T C 15: 50,661,246 Y1096C probably damaging Het
Usp40 A T 1: 87,983,769 L512Q probably benign Het
Vmn1r175 T C 7: 23,808,978 T75A probably benign Het
Zan A G 5: 137,427,864 V2550A unknown Het
Zfp235 A T 7: 24,140,499 E114D possibly damaging Het
Zmym1 A T 4: 127,051,372 D141E probably damaging Het
Other mutations in Ccdc50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc50 APN 16 27409352 missense probably damaging 1.00
IGL02725:Ccdc50 APN 16 27436597 missense probably benign 0.38
IGL02742:Ccdc50 APN 16 27406784 splice site probably benign
R0310:Ccdc50 UTSW 16 27406658 missense probably damaging 1.00
R0582:Ccdc50 UTSW 16 27444659 splice site probably benign
R1993:Ccdc50 UTSW 16 27409339 nonsense probably null
R2844:Ccdc50 UTSW 16 27406729 missense probably damaging 1.00
R3121:Ccdc50 UTSW 16 27409389 missense possibly damaging 0.89
R3923:Ccdc50 UTSW 16 27444544 missense probably damaging 1.00
R4624:Ccdc50 UTSW 16 27436601 missense probably null 0.77
R5057:Ccdc50 UTSW 16 27438342 missense probably benign 0.00
R5339:Ccdc50 UTSW 16 27417305 missense probably damaging 0.99
R7673:Ccdc50 UTSW 16 27406675 missense possibly damaging 0.84
R8355:Ccdc50 UTSW 16 27417351 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCATTAGCAGCAAAACTCC -3'
(R):5'- CCAAAGATGACTTTTCTCGCTC -3'

Sequencing Primer
(F):5'- GCAAAACTCCATATTCTGATGTCTGC -3'
(R):5'- AAAGATGACTTTTCTCGCTCTTTGG -3'
Posted On2021-03-08