Incidental Mutation 'R8745:Fn1'
ID663458
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8745 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71637369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 568 (T568A)
Ref Sequence ENSEMBL: ENSMUSP00000054499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
PDB Structure SOLUTION NMR STRUCTURE OF LINKED CELL ATTACHMENT MODULES OF MOUSE FIBRONECTIN CONTAINING THE RGD AND SYNERGY REGIONS, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF LINKED CELL ATTACHMENT MODULES OF MOUSE FIBRONECTIN CONTAINING THE RGD AND SYNERGY REGIONS, 10 STRUCTURES [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055226
AA Change: T568A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186129
AA Change: T568A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186613
Predicted Effect possibly damaging
Transcript: ENSMUST00000187938
AA Change: T568A

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188674
AA Change: T568A

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188894
AA Change: T568A

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189821
AA Change: T568A

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190780
AA Change: T568A

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193
AA Change: T568A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,634,443 N377S probably benign Het
Aldh3b3 A T 19: 3,964,890 Y129F possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd61 G A 5: 143,891,419 S246L possibly damaging Het
BC037034 A G 5: 138,263,065 probably null Het
Ccdc187 T A 2: 26,280,514 I651F probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfap58 A T 19: 47,941,114 K5* probably null Het
Col27a1 T C 4: 63,225,916 S614P probably benign Het
Crlf3 T A 11: 80,064,274 E85D probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnah7b A G 1: 46,182,464 I1243V possibly damaging Het
Dnajc22 A G 15: 99,101,464 T177A probably benign Het
Dytn A T 1: 63,647,447 C355S probably benign Het
Ehbp1 T C 11: 22,169,064 N202S possibly damaging Het
Exoc3l2 T C 7: 19,481,287 I491T unknown Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fam53a A T 5: 33,610,437 I43N probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Gba A T 3: 89,207,873 N404I probably damaging Het
Gm11639 C T 11: 104,858,478 T2340M possibly damaging Het
Gsap A G 5: 21,269,951 Y536C probably benign Het
Hecw2 T A 1: 53,933,171 E230V probably damaging Het
Heg1 A G 16: 33,735,616 Q1046R probably benign Het
Kctd14 G A 7: 97,458,238 W233* probably null Het
Krt88 T C 15: 101,453,579 S156P possibly damaging Het
L3mbtl1 C A 2: 162,970,217 H727Q probably benign Het
Man1c1 T C 4: 134,575,984 K400E probably damaging Het
Map2 A T 1: 66,413,397 Q482L probably benign Het
Map3k1 A G 13: 111,756,772 V733A probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Map4k3 G A 17: 80,636,735 R328C possibly damaging Het
March7 C T 2: 60,236,809 Q558* probably null Het
Mepe T C 5: 104,337,659 S222P possibly damaging Het
Mfap3l A T 8: 60,671,924 N400I possibly damaging Het
Myom3 T C 4: 135,795,198 probably null Het
Nav3 T C 10: 109,823,450 T769A probably benign Het
Ndufb7 T A 8: 83,570,889 Y58N probably damaging Het
Nup160 T C 2: 90,700,119 F445L probably benign Het
Olfr1198 T C 2: 88,746,064 I275V possibly damaging Het
Olfr1261 T A 2: 89,993,732 M113K probably damaging Het
Olfr379-ps1 C A 11: 73,434,022 *68L probably null Het
Ovch2 G A 7: 107,790,377 S321F possibly damaging Het
Pamr1 T C 2: 102,611,579 L171P probably damaging Het
Pcdhga5 T C 18: 37,695,921 V474A possibly damaging Het
Pcgf6 A G 19: 47,050,720 S34P probably benign Het
Pitrm1 C T 13: 6,553,202 P96L probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ranbp1 A G 16: 18,247,380 S21P possibly damaging Het
Rasgrp2 G T 19: 6,413,919 R549L probably damaging Het
Rassf10 T A 7: 112,954,876 L228Q probably damaging Het
Rho A T 6: 115,935,522 I275F probably damaging Het
Rrp9 T C 9: 106,484,458 V400A possibly damaging Het
Satb2 A G 1: 56,969,637 L62P unknown Het
Scmh1 T A 4: 120,505,362 L265* probably null Het
Scn7a A G 2: 66,680,182 M1292T probably benign Het
Serpinb10 A T 1: 107,546,812 T235S probably benign Het
Serpinb6c A G 13: 33,880,719 V214A probably benign Het
Sf3b3 A G 8: 110,824,184 I616T possibly damaging Het
Shb G C 4: 45,458,319 R282G probably benign Het
Snx5 A T 2: 144,262,012 S22T probably benign Het
Spata6 T C 4: 111,779,279 F256L probably benign Het
St5 T A 7: 109,557,072 H157L probably benign Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Sva T A 6: 42,038,423 M1K probably null Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Tex9 T C 9: 72,482,496 I111V probably benign Het
Tigd4 A G 3: 84,594,567 I264V probably benign Het
Tmem182 C T 1: 40,838,376 A137V probably damaging Het
Tnfrsf1a A G 6: 125,361,782 I385V probably damaging Het
Tnrc18 A T 5: 142,787,447 F542L Het
Tpbpa G A 13: 60,939,964 T86I possibly damaging Het
Ubr5 G A 15: 38,024,795 P573L Het
Usp54 A G 14: 20,562,108 I880T probably benign Het
Vmn1r9 A G 6: 57,071,782 I281V probably benign Het
Zfp456 C A 13: 67,367,254 C111F possibly damaging Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
R0386_Fn1_271 UTSW 1 71595786 missense probably damaging 1.00
R0684_Fn1_062 UTSW 1 71595809 splice site probably null
R3906_Fn1_168 UTSW 1 71607913 missense probably damaging 1.00
R7508_Fn1_874 UTSW 1 71597516 missense probably benign 0.01
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0112:Fn1 UTSW 1 71609653 missense probably damaging 1.00
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0648:Fn1 UTSW 1 71597585 missense possibly damaging 0.79
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2113:Fn1 UTSW 1 71626164 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 splice site probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4809:Fn1 UTSW 1 71652800 intron probably benign
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 splice site probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7121:Fn1 UTSW 1 71600538 intron probably benign
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7285:Fn1 UTSW 1 71637339 missense probably damaging 1.00
R7426:Fn1 UTSW 1 71649225 missense probably damaging 1.00
R7453:Fn1 UTSW 1 71590880 missense probably damaging 1.00
R7508:Fn1 UTSW 1 71597516 missense probably benign 0.01
R7724:Fn1 UTSW 1 71603735 missense probably benign 0.02
R7848:Fn1 UTSW 1 71650601 missense probably damaging 1.00
R7992:Fn1 UTSW 1 71599666 missense probably benign 0.34
R8036:Fn1 UTSW 1 71590151 nonsense probably null
R8077:Fn1 UTSW 1 71612602 missense probably damaging 1.00
R8175:Fn1 UTSW 1 71599665 missense probably damaging 1.00
R8177:Fn1 UTSW 1 71609587 missense probably benign
R8212:Fn1 UTSW 1 71642905 missense probably benign 0.01
R8322:Fn1 UTSW 1 71628459 missense probably benign 0.04
R8780:Fn1 UTSW 1 71643149 missense probably benign 0.00
R8805:Fn1 UTSW 1 71605080 missense probably benign 0.27
R8928:Fn1 UTSW 1 71599376 missense probably benign 0.16
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Z1176:Fn1 UTSW 1 71597411 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAATAGTAGCATAGACTGGCATCC -3'
(R):5'- TACTTTAGGACTGGGGAAATGG -3'

Sequencing Primer
(F):5'- ATAGACTGGCATCCATGGGTC -3'
(R):5'- TGGTTTCACACAACATATGCACG -3'
Posted On2021-03-08