Incidental Mutation 'R8745:Scn7a'
ID 663462
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 068589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66510526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1292 (M1292T)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably benign
Transcript: ENSMUST00000042792
AA Change: M1292T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: M1292T

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,611,807 (GRCm39) N377S probably benign Het
Aldh3b3 A T 19: 4,014,890 (GRCm39) Y129F possibly damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Ankrd61 G A 5: 143,828,237 (GRCm39) S246L possibly damaging Het
Ccdc187 T A 2: 26,170,526 (GRCm39) I651F probably damaging Het
Cdc40 C T 10: 40,717,480 (GRCm39) D404N probably damaging Het
Ceacam13 T A 7: 17,743,934 (GRCm39) S14T probably damaging Het
Cfap58 A T 19: 47,929,553 (GRCm39) K5* probably null Het
Col27a1 T C 4: 63,144,153 (GRCm39) S614P probably benign Het
Crlf3 T A 11: 79,955,100 (GRCm39) E85D probably damaging Het
Dennd2b T A 7: 109,156,279 (GRCm39) H157L probably benign Het
Dlat G T 9: 50,560,967 (GRCm39) A360E probably damaging Het
Dnah7b A G 1: 46,221,624 (GRCm39) I1243V possibly damaging Het
Dnajc22 A G 15: 98,999,345 (GRCm39) T177A probably benign Het
Dytn A T 1: 63,686,606 (GRCm39) C355S probably benign Het
Efcab3 C T 11: 104,749,304 (GRCm39) T2340M possibly damaging Het
Ehbp1 T C 11: 22,119,064 (GRCm39) N202S possibly damaging Het
Exoc3l2 T C 7: 19,215,212 (GRCm39) I491T unknown Het
Fam135a G A 1: 24,067,569 (GRCm39) T1100M probably benign Het
Fam53a A T 5: 33,767,781 (GRCm39) I43N probably damaging Het
Fis1 G T 5: 136,982,365 (GRCm39) probably benign Het
Fn1 T C 1: 71,676,528 (GRCm39) T568A probably benign Het
Gba1 A T 3: 89,115,180 (GRCm39) N404I probably damaging Het
Gsap A G 5: 21,474,949 (GRCm39) Y536C probably benign Het
Hecw2 T A 1: 53,972,330 (GRCm39) E230V probably damaging Het
Heg1 A G 16: 33,555,986 (GRCm39) Q1046R probably benign Het
Kctd14 G A 7: 97,107,445 (GRCm39) W233* probably null Het
Krt88 T C 15: 101,351,460 (GRCm39) S156P possibly damaging Het
L3mbtl1 C A 2: 162,812,137 (GRCm39) H727Q probably benign Het
Man1c1 T C 4: 134,303,295 (GRCm39) K400E probably damaging Het
Map2 A T 1: 66,452,556 (GRCm39) Q482L probably benign Het
Map3k1 A G 13: 111,893,306 (GRCm39) V733A probably damaging Het
Map4k1 G A 7: 28,686,542 (GRCm39) D155N probably damaging Het
Map4k3 G A 17: 80,944,164 (GRCm39) R328C possibly damaging Het
Marchf7 C T 2: 60,067,153 (GRCm39) Q558* probably null Het
Mepe T C 5: 104,485,525 (GRCm39) S222P possibly damaging Het
Mfap3l A T 8: 61,124,958 (GRCm39) N400I possibly damaging Het
Myom3 T C 4: 135,522,509 (GRCm39) probably null Het
Nav3 T C 10: 109,659,311 (GRCm39) T769A probably benign Het
Ndufb7 T A 8: 84,297,518 (GRCm39) Y58N probably damaging Het
Nup160 T C 2: 90,530,463 (GRCm39) F445L probably benign Het
Or1e20-ps1 C A 11: 73,324,848 (GRCm39) *68L probably null Het
Or4c126 T A 2: 89,824,076 (GRCm39) M113K probably damaging Het
Or4p23 T C 2: 88,576,408 (GRCm39) I275V possibly damaging Het
Ovch2 G A 7: 107,389,584 (GRCm39) S321F possibly damaging Het
Pamr1 T C 2: 102,441,924 (GRCm39) L171P probably damaging Het
Pcdhga5 T C 18: 37,828,974 (GRCm39) V474A possibly damaging Het
Pcgf6 A G 19: 47,039,159 (GRCm39) S34P probably benign Het
Pitrm1 C T 13: 6,603,238 (GRCm39) P96L probably damaging Het
Polr1a T C 6: 71,931,755 (GRCm39) F945L probably damaging Het
Ranbp1 A G 16: 18,065,244 (GRCm39) S21P possibly damaging Het
Rasgrp2 G T 19: 6,463,949 (GRCm39) R549L probably damaging Het
Rassf10 T A 7: 112,554,083 (GRCm39) L228Q probably damaging Het
Rho A T 6: 115,912,483 (GRCm39) I275F probably damaging Het
Rrp9 T C 9: 106,361,657 (GRCm39) V400A possibly damaging Het
Satb2 A G 1: 57,008,796 (GRCm39) L62P unknown Het
Scmh1 T A 4: 120,362,559 (GRCm39) L265* probably null Het
Serpinb10 A T 1: 107,474,542 (GRCm39) T235S probably benign Het
Serpinb6c A G 13: 34,064,702 (GRCm39) V214A probably benign Het
Sf3b3 A G 8: 111,550,816 (GRCm39) I616T possibly damaging Het
Shb G C 4: 45,458,319 (GRCm39) R282G probably benign Het
Snx5 A T 2: 144,103,932 (GRCm39) S22T probably benign Het
Spata6 T C 4: 111,636,476 (GRCm39) F256L probably benign Het
Stab2 T C 10: 86,805,213 (GRCm39) H255R probably benign Het
Sva T A 6: 42,015,357 (GRCm39) M1K probably null Het
Tdpoz4 A T 3: 93,704,221 (GRCm39) T173S probably benign Het
Tex9 T C 9: 72,389,778 (GRCm39) I111V probably benign Het
Tigd4 A G 3: 84,501,874 (GRCm39) I264V probably benign Het
Tmem182 C T 1: 40,877,536 (GRCm39) A137V probably damaging Het
Tnfrsf1a A G 6: 125,338,745 (GRCm39) I385V probably damaging Het
Tnrc18 A T 5: 142,773,202 (GRCm39) F542L Het
Tpbpa G A 13: 61,087,778 (GRCm39) T86I possibly damaging Het
Trappc14 A G 5: 138,261,327 (GRCm39) probably null Het
Ubr5 G A 15: 38,025,039 (GRCm39) P573L Het
Usp54 A G 14: 20,612,176 (GRCm39) I880T probably benign Het
Vmn1r9 A G 6: 57,048,767 (GRCm39) I281V probably benign Het
Zfp456 C A 13: 67,515,373 (GRCm39) C111F possibly damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTGCTTCTTCAAGGTCAC -3'
(R):5'- TTGACAAAGGATTCAAGTGCTG -3'

Sequencing Primer
(F):5'- GGTCACCATCTCAATACATATTGTG -3'
(R):5'- GACAAAGGATTCAAGTGCTGTTTTTG -3'
Posted On 2021-03-08