Incidental Mutation 'R8745:Polr1a'
ID663488
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8745 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71954771 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 945 (F945L)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296] [ENSMUST00000206556]
Predicted Effect probably damaging
Transcript: ENSMUST00000055296
AA Change: F945L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: F945L

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206513
Predicted Effect probably benign
Transcript: ENSMUST00000206556
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,634,443 N377S probably benign Het
Aldh3b3 A T 19: 3,964,890 Y129F possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd61 G A 5: 143,891,419 S246L possibly damaging Het
BC037034 A G 5: 138,263,065 probably null Het
Ccdc187 T A 2: 26,280,514 I651F probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfap58 A T 19: 47,941,114 K5* probably null Het
Col27a1 T C 4: 63,225,916 S614P probably benign Het
Crlf3 T A 11: 80,064,274 E85D probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnah7b A G 1: 46,182,464 I1243V possibly damaging Het
Dnajc22 A G 15: 99,101,464 T177A probably benign Het
Dytn A T 1: 63,647,447 C355S probably benign Het
Ehbp1 T C 11: 22,169,064 N202S possibly damaging Het
Exoc3l2 T C 7: 19,481,287 I491T unknown Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fam53a A T 5: 33,610,437 I43N probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Fn1 T C 1: 71,637,369 T568A probably benign Het
Gba A T 3: 89,207,873 N404I probably damaging Het
Gm11639 C T 11: 104,858,478 T2340M possibly damaging Het
Gsap A G 5: 21,269,951 Y536C probably benign Het
Hecw2 T A 1: 53,933,171 E230V probably damaging Het
Heg1 A G 16: 33,735,616 Q1046R probably benign Het
Kctd14 G A 7: 97,458,238 W233* probably null Het
Krt88 T C 15: 101,453,579 S156P possibly damaging Het
L3mbtl1 C A 2: 162,970,217 H727Q probably benign Het
Man1c1 T C 4: 134,575,984 K400E probably damaging Het
Map2 A T 1: 66,413,397 Q482L probably benign Het
Map3k1 A G 13: 111,756,772 V733A probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Map4k3 G A 17: 80,636,735 R328C possibly damaging Het
March7 C T 2: 60,236,809 Q558* probably null Het
Mepe T C 5: 104,337,659 S222P possibly damaging Het
Mfap3l A T 8: 60,671,924 N400I possibly damaging Het
Myom3 T C 4: 135,795,198 probably null Het
Nav3 T C 10: 109,823,450 T769A probably benign Het
Ndufb7 T A 8: 83,570,889 Y58N probably damaging Het
Nup160 T C 2: 90,700,119 F445L probably benign Het
Olfr1198 T C 2: 88,746,064 I275V possibly damaging Het
Olfr1261 T A 2: 89,993,732 M113K probably damaging Het
Olfr379-ps1 C A 11: 73,434,022 *68L probably null Het
Ovch2 G A 7: 107,790,377 S321F possibly damaging Het
Pamr1 T C 2: 102,611,579 L171P probably damaging Het
Pcdhga5 T C 18: 37,695,921 V474A possibly damaging Het
Pcgf6 A G 19: 47,050,720 S34P probably benign Het
Pitrm1 C T 13: 6,553,202 P96L probably damaging Het
Ranbp1 A G 16: 18,247,380 S21P possibly damaging Het
Rasgrp2 G T 19: 6,413,919 R549L probably damaging Het
Rassf10 T A 7: 112,954,876 L228Q probably damaging Het
Rho A T 6: 115,935,522 I275F probably damaging Het
Rrp9 T C 9: 106,484,458 V400A possibly damaging Het
Satb2 A G 1: 56,969,637 L62P unknown Het
Scmh1 T A 4: 120,505,362 L265* probably null Het
Scn7a A G 2: 66,680,182 M1292T probably benign Het
Serpinb10 A T 1: 107,546,812 T235S probably benign Het
Serpinb6c A G 13: 33,880,719 V214A probably benign Het
Sf3b3 A G 8: 110,824,184 I616T possibly damaging Het
Shb G C 4: 45,458,319 R282G probably benign Het
Snx5 A T 2: 144,262,012 S22T probably benign Het
Spata6 T C 4: 111,779,279 F256L probably benign Het
St5 T A 7: 109,557,072 H157L probably benign Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Sva T A 6: 42,038,423 M1K probably null Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Tex9 T C 9: 72,482,496 I111V probably benign Het
Tigd4 A G 3: 84,594,567 I264V probably benign Het
Tmem182 C T 1: 40,838,376 A137V probably damaging Het
Tnfrsf1a A G 6: 125,361,782 I385V probably damaging Het
Tnrc18 A T 5: 142,787,447 F542L Het
Tpbpa G A 13: 60,939,964 T86I possibly damaging Het
Ubr5 G A 15: 38,024,795 P573L Het
Usp54 A G 14: 20,562,108 I880T probably benign Het
Vmn1r9 A G 6: 57,071,782 I281V probably benign Het
Zfp456 C A 13: 67,367,254 C111F possibly damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0267:Polr1a UTSW 6 71974139 missense probably damaging 0.99
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
R8709:Polr1a UTSW 6 71974848 missense probably benign
R8784:Polr1a UTSW 6 71950628 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCAAATGCTTTCCCTGAGG -3'
(R):5'- CCTAGTATCACAGTGGGCATCTC -3'

Sequencing Primer
(F):5'- CCTGAGGGAAAGCTGGAAGTCC -3'
(R):5'- ATCACAGTGGGCATCTCCATGTG -3'
Posted On2021-03-08