Incidental Mutation 'R8745:Ceacam13'
ID663491
Institutional Source Beutler Lab
Gene Symbol Ceacam13
Ensembl Gene ENSMUSG00000057195
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 13
Synonyms1600025J19Rik, Ceacam13-C2, Ceacam13-C1, 1600012K03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8745 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18009889-18019221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18010009 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 14 (S14T)
Ref Sequence ENSEMBL: ENSMUSP00000080404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081703] [ENSMUST00000108488]
Predicted Effect probably damaging
Transcript: ENSMUST00000081703
AA Change: S14T

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080404
Gene: ENSMUSG00000057195
AA Change: S14T

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108488
AA Change: S14T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104128
Gene: ENSMUSG00000057195
AA Change: S14T

DomainStartEndE-ValueType
IG_like 40 143 1.37e1 SMART
IG_like 158 261 8.97e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,634,443 N377S probably benign Het
Aldh3b3 A T 19: 3,964,890 Y129F possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd61 G A 5: 143,891,419 S246L possibly damaging Het
BC037034 A G 5: 138,263,065 probably null Het
Ccdc187 T A 2: 26,280,514 I651F probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Cfap58 A T 19: 47,941,114 K5* probably null Het
Col27a1 T C 4: 63,225,916 S614P probably benign Het
Crlf3 T A 11: 80,064,274 E85D probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnah7b A G 1: 46,182,464 I1243V possibly damaging Het
Dnajc22 A G 15: 99,101,464 T177A probably benign Het
Dytn A T 1: 63,647,447 C355S probably benign Het
Ehbp1 T C 11: 22,169,064 N202S possibly damaging Het
Exoc3l2 T C 7: 19,481,287 I491T unknown Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fam53a A T 5: 33,610,437 I43N probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Fn1 T C 1: 71,637,369 T568A probably benign Het
Gba A T 3: 89,207,873 N404I probably damaging Het
Gm11639 C T 11: 104,858,478 T2340M possibly damaging Het
Gsap A G 5: 21,269,951 Y536C probably benign Het
Hecw2 T A 1: 53,933,171 E230V probably damaging Het
Heg1 A G 16: 33,735,616 Q1046R probably benign Het
Kctd14 G A 7: 97,458,238 W233* probably null Het
Krt88 T C 15: 101,453,579 S156P possibly damaging Het
L3mbtl1 C A 2: 162,970,217 H727Q probably benign Het
Man1c1 T C 4: 134,575,984 K400E probably damaging Het
Map2 A T 1: 66,413,397 Q482L probably benign Het
Map3k1 A G 13: 111,756,772 V733A probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Map4k3 G A 17: 80,636,735 R328C possibly damaging Het
March7 C T 2: 60,236,809 Q558* probably null Het
Mepe T C 5: 104,337,659 S222P possibly damaging Het
Mfap3l A T 8: 60,671,924 N400I possibly damaging Het
Myom3 T C 4: 135,795,198 probably null Het
Nav3 T C 10: 109,823,450 T769A probably benign Het
Ndufb7 T A 8: 83,570,889 Y58N probably damaging Het
Nup160 T C 2: 90,700,119 F445L probably benign Het
Olfr1198 T C 2: 88,746,064 I275V possibly damaging Het
Olfr1261 T A 2: 89,993,732 M113K probably damaging Het
Olfr379-ps1 C A 11: 73,434,022 *68L probably null Het
Ovch2 G A 7: 107,790,377 S321F possibly damaging Het
Pamr1 T C 2: 102,611,579 L171P probably damaging Het
Pcdhga5 T C 18: 37,695,921 V474A possibly damaging Het
Pcgf6 A G 19: 47,050,720 S34P probably benign Het
Pitrm1 C T 13: 6,553,202 P96L probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ranbp1 A G 16: 18,247,380 S21P possibly damaging Het
Rasgrp2 G T 19: 6,413,919 R549L probably damaging Het
Rassf10 T A 7: 112,954,876 L228Q probably damaging Het
Rho A T 6: 115,935,522 I275F probably damaging Het
Rrp9 T C 9: 106,484,458 V400A possibly damaging Het
Satb2 A G 1: 56,969,637 L62P unknown Het
Scmh1 T A 4: 120,505,362 L265* probably null Het
Scn7a A G 2: 66,680,182 M1292T probably benign Het
Serpinb10 A T 1: 107,546,812 T235S probably benign Het
Serpinb6c A G 13: 33,880,719 V214A probably benign Het
Sf3b3 A G 8: 110,824,184 I616T possibly damaging Het
Shb G C 4: 45,458,319 R282G probably benign Het
Snx5 A T 2: 144,262,012 S22T probably benign Het
Spata6 T C 4: 111,779,279 F256L probably benign Het
St5 T A 7: 109,557,072 H157L probably benign Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Sva T A 6: 42,038,423 M1K probably null Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Tex9 T C 9: 72,482,496 I111V probably benign Het
Tigd4 A G 3: 84,594,567 I264V probably benign Het
Tmem182 C T 1: 40,838,376 A137V probably damaging Het
Tnfrsf1a A G 6: 125,361,782 I385V probably damaging Het
Tnrc18 A T 5: 142,787,447 F542L Het
Tpbpa G A 13: 60,939,964 T86I possibly damaging Het
Ubr5 G A 15: 38,024,795 P573L Het
Usp54 A G 14: 20,562,108 I880T probably benign Het
Vmn1r9 A G 6: 57,071,782 I281V probably benign Het
Zfp456 C A 13: 67,367,254 C111F possibly damaging Het
Other mutations in Ceacam13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Ceacam13 APN 7 18013353 missense possibly damaging 0.59
IGL01617:Ceacam13 APN 7 18011383 missense possibly damaging 0.53
IGL02948:Ceacam13 APN 7 18011063 splice site probably benign
R1508:Ceacam13 UTSW 7 18011071 missense possibly damaging 0.89
R3794:Ceacam13 UTSW 7 18013415 makesense probably null
R4882:Ceacam13 UTSW 7 18013072 missense probably benign 0.20
R6859:Ceacam13 UTSW 7 18013107 missense probably damaging 1.00
R8081:Ceacam13 UTSW 7 18013188 missense probably damaging 1.00
R8742:Ceacam13 UTSW 7 18010009 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACACAGGAAATGTCCCCAGG -3'
(R):5'- AGTGCTATTGCTCCATTGTACTATC -3'

Sequencing Primer
(F):5'- ATGTCCCCAGGCCATATAATTCTAGG -3'
(R):5'- ATTGCTCCATTGTACTATCTTGTG -3'
Posted On2021-03-08