Incidental Mutation 'R8745:Serpinb6c'
ID 663512
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8745 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33880719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184]
AlphaFold W4VSP4
Predicted Effect probably benign
Transcript: ENSMUST00000110273
AA Change: V214A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: V214A

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172184
AA Change: V214A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: V214A

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,634,443 N377S probably benign Het
Aldh3b3 A T 19: 3,964,890 Y129F possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd61 G A 5: 143,891,419 S246L possibly damaging Het
BC037034 A G 5: 138,263,065 probably null Het
Ccdc187 T A 2: 26,280,514 I651F probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfap58 A T 19: 47,941,114 K5* probably null Het
Col27a1 T C 4: 63,225,916 S614P probably benign Het
Crlf3 T A 11: 80,064,274 E85D probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnah7b A G 1: 46,182,464 I1243V possibly damaging Het
Dnajc22 A G 15: 99,101,464 T177A probably benign Het
Dytn A T 1: 63,647,447 C355S probably benign Het
Ehbp1 T C 11: 22,169,064 N202S possibly damaging Het
Exoc3l2 T C 7: 19,481,287 I491T unknown Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fam53a A T 5: 33,610,437 I43N probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Fn1 T C 1: 71,637,369 T568A probably benign Het
Gba A T 3: 89,207,873 N404I probably damaging Het
Gm11639 C T 11: 104,858,478 T2340M possibly damaging Het
Gsap A G 5: 21,269,951 Y536C probably benign Het
Hecw2 T A 1: 53,933,171 E230V probably damaging Het
Heg1 A G 16: 33,735,616 Q1046R probably benign Het
Kctd14 G A 7: 97,458,238 W233* probably null Het
Krt88 T C 15: 101,453,579 S156P possibly damaging Het
L3mbtl1 C A 2: 162,970,217 H727Q probably benign Het
Man1c1 T C 4: 134,575,984 K400E probably damaging Het
Map2 A T 1: 66,413,397 Q482L probably benign Het
Map3k1 A G 13: 111,756,772 V733A probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Map4k3 G A 17: 80,636,735 R328C possibly damaging Het
March7 C T 2: 60,236,809 Q558* probably null Het
Mepe T C 5: 104,337,659 S222P possibly damaging Het
Mfap3l A T 8: 60,671,924 N400I possibly damaging Het
Myom3 T C 4: 135,795,198 probably null Het
Nav3 T C 10: 109,823,450 T769A probably benign Het
Ndufb7 T A 8: 83,570,889 Y58N probably damaging Het
Nup160 T C 2: 90,700,119 F445L probably benign Het
Olfr1198 T C 2: 88,746,064 I275V possibly damaging Het
Olfr1261 T A 2: 89,993,732 M113K probably damaging Het
Olfr379-ps1 C A 11: 73,434,022 *68L probably null Het
Ovch2 G A 7: 107,790,377 S321F possibly damaging Het
Pamr1 T C 2: 102,611,579 L171P probably damaging Het
Pcdhga5 T C 18: 37,695,921 V474A possibly damaging Het
Pcgf6 A G 19: 47,050,720 S34P probably benign Het
Pitrm1 C T 13: 6,553,202 P96L probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ranbp1 A G 16: 18,247,380 S21P possibly damaging Het
Rasgrp2 G T 19: 6,413,919 R549L probably damaging Het
Rassf10 T A 7: 112,954,876 L228Q probably damaging Het
Rho A T 6: 115,935,522 I275F probably damaging Het
Rrp9 T C 9: 106,484,458 V400A possibly damaging Het
Satb2 A G 1: 56,969,637 L62P unknown Het
Scmh1 T A 4: 120,505,362 L265* probably null Het
Scn7a A G 2: 66,680,182 M1292T probably benign Het
Serpinb10 A T 1: 107,546,812 T235S probably benign Het
Sf3b3 A G 8: 110,824,184 I616T possibly damaging Het
Shb G C 4: 45,458,319 R282G probably benign Het
Snx5 A T 2: 144,262,012 S22T probably benign Het
Spata6 T C 4: 111,779,279 F256L probably benign Het
St5 T A 7: 109,557,072 H157L probably benign Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Sva T A 6: 42,038,423 M1K probably null Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Tex9 T C 9: 72,482,496 I111V probably benign Het
Tigd4 A G 3: 84,594,567 I264V probably benign Het
Tmem182 C T 1: 40,838,376 A137V probably damaging Het
Tnfrsf1a A G 6: 125,361,782 I385V probably damaging Het
Tnrc18 A T 5: 142,787,447 F542L Het
Tpbpa G A 13: 60,939,964 T86I possibly damaging Het
Ubr5 G A 15: 38,024,795 P573L Het
Usp54 A G 14: 20,562,108 I880T probably benign Het
Vmn1r9 A G 6: 57,071,782 I281V probably benign Het
Zfp456 C A 13: 67,367,254 C111F possibly damaging Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8855:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R8866:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R9412:Serpinb6c UTSW 13 33897388 missense probably benign 0.00
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGATCATGGGAGCCTAGGAG -3'
(R):5'- GGCATGGAAAGTCTAAACTGTTTCAG -3'

Sequencing Primer
(F):5'- AGCCTAGGAGAGCTGCC -3'
(R):5'- AACTGTTTCAGACATTTAGAGGC -3'
Posted On 2021-03-08