Incidental Mutation 'R8745:Ubr5'
ID663517
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8745 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38024795 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 573 (P573L)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: P573L

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000226414
AA Change: P579L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 A G 19: 20,634,443 N377S probably benign Het
Aldh3b3 A T 19: 3,964,890 Y129F possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd61 G A 5: 143,891,419 S246L possibly damaging Het
BC037034 A G 5: 138,263,065 probably null Het
Ccdc187 T A 2: 26,280,514 I651F probably damaging Het
Cdc40 C T 10: 40,841,484 D404N probably damaging Het
Ceacam13 T A 7: 18,010,009 S14T probably damaging Het
Cfap58 A T 19: 47,941,114 K5* probably null Het
Col27a1 T C 4: 63,225,916 S614P probably benign Het
Crlf3 T A 11: 80,064,274 E85D probably damaging Het
Dlat G T 9: 50,649,667 A360E probably damaging Het
Dnah7b A G 1: 46,182,464 I1243V possibly damaging Het
Dnajc22 A G 15: 99,101,464 T177A probably benign Het
Dytn A T 1: 63,647,447 C355S probably benign Het
Ehbp1 T C 11: 22,169,064 N202S possibly damaging Het
Exoc3l2 T C 7: 19,481,287 I491T unknown Het
Fam135a G A 1: 24,028,488 T1100M probably benign Het
Fam53a A T 5: 33,610,437 I43N probably damaging Het
Fis1 G T 5: 136,953,511 probably benign Het
Fn1 T C 1: 71,637,369 T568A probably benign Het
Gba A T 3: 89,207,873 N404I probably damaging Het
Gm11639 C T 11: 104,858,478 T2340M possibly damaging Het
Gsap A G 5: 21,269,951 Y536C probably benign Het
Hecw2 T A 1: 53,933,171 E230V probably damaging Het
Heg1 A G 16: 33,735,616 Q1046R probably benign Het
Kctd14 G A 7: 97,458,238 W233* probably null Het
Krt88 T C 15: 101,453,579 S156P possibly damaging Het
L3mbtl1 C A 2: 162,970,217 H727Q probably benign Het
Man1c1 T C 4: 134,575,984 K400E probably damaging Het
Map2 A T 1: 66,413,397 Q482L probably benign Het
Map3k1 A G 13: 111,756,772 V733A probably damaging Het
Map4k1 G A 7: 28,987,117 D155N probably damaging Het
Map4k3 G A 17: 80,636,735 R328C possibly damaging Het
March7 C T 2: 60,236,809 Q558* probably null Het
Mepe T C 5: 104,337,659 S222P possibly damaging Het
Mfap3l A T 8: 60,671,924 N400I possibly damaging Het
Myom3 T C 4: 135,795,198 probably null Het
Nav3 T C 10: 109,823,450 T769A probably benign Het
Ndufb7 T A 8: 83,570,889 Y58N probably damaging Het
Nup160 T C 2: 90,700,119 F445L probably benign Het
Olfr1198 T C 2: 88,746,064 I275V possibly damaging Het
Olfr1261 T A 2: 89,993,732 M113K probably damaging Het
Olfr379-ps1 C A 11: 73,434,022 *68L probably null Het
Ovch2 G A 7: 107,790,377 S321F possibly damaging Het
Pamr1 T C 2: 102,611,579 L171P probably damaging Het
Pcdhga5 T C 18: 37,695,921 V474A possibly damaging Het
Pcgf6 A G 19: 47,050,720 S34P probably benign Het
Pitrm1 C T 13: 6,553,202 P96L probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ranbp1 A G 16: 18,247,380 S21P possibly damaging Het
Rasgrp2 G T 19: 6,413,919 R549L probably damaging Het
Rassf10 T A 7: 112,954,876 L228Q probably damaging Het
Rho A T 6: 115,935,522 I275F probably damaging Het
Rrp9 T C 9: 106,484,458 V400A possibly damaging Het
Satb2 A G 1: 56,969,637 L62P unknown Het
Scmh1 T A 4: 120,505,362 L265* probably null Het
Scn7a A G 2: 66,680,182 M1292T probably benign Het
Serpinb10 A T 1: 107,546,812 T235S probably benign Het
Serpinb6c A G 13: 33,880,719 V214A probably benign Het
Sf3b3 A G 8: 110,824,184 I616T possibly damaging Het
Shb G C 4: 45,458,319 R282G probably benign Het
Snx5 A T 2: 144,262,012 S22T probably benign Het
Spata6 T C 4: 111,779,279 F256L probably benign Het
St5 T A 7: 109,557,072 H157L probably benign Het
Stab2 T C 10: 86,969,349 H255R probably benign Het
Sva T A 6: 42,038,423 M1K probably null Het
Tdpoz4 A T 3: 93,796,914 T173S probably benign Het
Tex9 T C 9: 72,482,496 I111V probably benign Het
Tigd4 A G 3: 84,594,567 I264V probably benign Het
Tmem182 C T 1: 40,838,376 A137V probably damaging Het
Tnfrsf1a A G 6: 125,361,782 I385V probably damaging Het
Tnrc18 A T 5: 142,787,447 F542L Het
Tpbpa G A 13: 60,939,964 T86I possibly damaging Het
Usp54 A G 14: 20,562,108 I880T probably benign Het
Vmn1r9 A G 6: 57,071,782 I281V probably benign Het
Zfp456 C A 13: 67,367,254 C111F possibly damaging Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
Anchovy UTSW 15 37979832 missense probably null
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7710:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7803:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37991322 missense probably damaging 0.97
R7841:Ubr5 UTSW 15 37980906 missense
R7869:Ubr5 UTSW 15 37979832 missense probably null
R7896:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R8191:Ubr5 UTSW 15 38006507 missense
R8342:Ubr5 UTSW 15 38024837 missense
R8811:Ubr5 UTSW 15 38040879 missense
R8904:Ubr5 UTSW 15 38041909 missense
R8955:Ubr5 UTSW 15 38029581 missense
R8956:Ubr5 UTSW 15 38015123 missense probably damaging 1.00
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38040755 missense
Predicted Primers PCR Primer
(F):5'- TTCTGACCACCATCAGGAAC -3'
(R):5'- CCTGCACGTTTGAACTGATTC -3'

Sequencing Primer
(F):5'- TACTGCTCTTCCAAAGGACTAGGG -3'
(R):5'- GCACGTTTGAACTGATTCTCGTTC -3'
Posted On2021-03-08