Incidental Mutation 'R8746:Ankrd34a'
ID663539
Institutional Source Beutler Lab
Gene Symbol Ankrd34a
Ensembl Gene ENSMUSG00000049097
Gene Nameankyrin repeat domain 34A
SynonymsAnkrd34
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8746 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96596636-96599775 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 96597475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058943] [ENSMUST00000062058] [ENSMUST00000091924] [ENSMUST00000145001]
Predicted Effect probably benign
Transcript: ENSMUST00000058943
SMART Domains Protein: ENSMUSP00000102707
Gene: ENSMUSG00000049097

DomainStartEndE-ValueType
ANK 4 33 9.05e2 SMART
ANK 37 72 2.81e-4 SMART
ANK 76 106 5.84e-2 SMART
ANK 110 139 7.99e2 SMART
low complexity region 216 244 N/A INTRINSIC
low complexity region 350 366 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091924
SMART Domains Protein: ENSMUSP00000089544
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 217 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145001
SMART Domains Protein: ENSMUSP00000118943
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 148 4.4e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,410 M871K probably benign Het
5530400C23Rik A C 6: 133,294,293 E100A possibly damaging Het
Aatf A T 11: 84,511,512 I116N probably benign Het
Adarb2 G T 13: 8,752,644 A652S probably benign Het
Adgb C T 10: 10,405,284 probably null Het
Ano2 A G 6: 125,863,550 I395V probably benign Het
Cadm2 C A 16: 66,784,809 R203L probably damaging Het
Ccr2 T C 9: 124,106,411 F243L probably benign Het
Ccr4 A G 9: 114,492,850 V49A probably damaging Het
Corin T C 5: 72,435,352 D234G probably benign Het
Drd5 G T 5: 38,320,090 R142I probably benign Het
Dsg1b A G 18: 20,395,999 D264G probably damaging Het
Ezh2 T C 6: 47,576,600 K61R probably damaging Het
Frmd4b T A 6: 97,292,409 T981S probably benign Het
Gcg T A 2: 62,474,981 K180N probably damaging Het
Gm10840 G A 11: 106,160,916 E23K unknown Het
Gm2696 T G 10: 77,815,203 C174W unknown Het
Grin2b T C 6: 135,922,987 I299V probably benign Het
Hepacam T A 9: 37,381,734 V207E probably damaging Het
Igf1r T A 7: 68,214,997 M1181K probably damaging Het
Lmo2 T C 2: 103,976,039 S96P possibly damaging Het
Marf1 T A 16: 14,117,304 E1533D probably benign Het
Megf9 A G 4: 70,435,274 C432R probably damaging Het
Mpp2 A G 11: 102,063,214 Y236H probably damaging Het
Neb T C 2: 52,282,601 I1565V probably damaging Het
Olfr1001-ps1 T A 2: 85,633,877 Y149* probably null Het
Olfr1392 A G 11: 49,293,166 probably benign Het
Olfr1469 A G 19: 13,410,728 D53G probably benign Het
Olfr203 T A 16: 59,303,610 F152L probably benign Het
Olfr308 C T 7: 86,321,229 C241Y probably damaging Het
Olfr663 A T 7: 104,703,860 I98F probably damaging Het
Olfr826 T C 10: 130,180,217 Y221C probably damaging Het
Pknox1 A T 17: 31,590,650 Q76L possibly damaging Het
Plekhg1 C A 10: 3,957,777 T953K Het
Plekhn1 C A 4: 156,232,225 R333L probably damaging Het
Plk5 T A 10: 80,358,776 V111D probably benign Het
Polr1b A G 2: 129,112,677 I398M possibly damaging Het
Ranbp3 T C 17: 56,702,826 V137A probably benign Het
Rc3h1 T A 1: 160,930,174 F21I probably damaging Het
Rgs8 T C 1: 153,671,791 S56P probably damaging Het
Rhpn1 G A 15: 75,713,576 V593M probably damaging Het
Sdad1 A G 5: 92,289,925 S589P probably benign Het
Skp1a A G 11: 52,246,016 K163R probably damaging Het
Slf2 A G 19: 44,973,624 Y1080C probably damaging Het
Tmem144 C T 3: 79,825,348 V208M probably damaging Het
Tmem2 G A 19: 21,826,101 G833R probably damaging Het
Tomm34 A T 2: 164,060,964 L142Q probably benign Het
Unc13b T A 4: 43,176,120 V2316D unknown Het
Yme1l1 T A 2: 23,162,531 S66T probably benign Het
Zfc3h1 T C 10: 115,407,980 S739P probably damaging Het
Zscan25 T A 5: 145,287,347 V209E possibly damaging Het
Other mutations in Ankrd34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Ankrd34a APN 3 96598913 missense probably benign 0.33
R0190:Ankrd34a UTSW 3 96597789 missense probably damaging 0.99
R1940:Ankrd34a UTSW 3 96598676 missense probably benign 0.28
R3779:Ankrd34a UTSW 3 96598931 missense possibly damaging 0.85
R5427:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5429:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5430:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R6129:Ankrd34a UTSW 3 96597958 nonsense probably null
R6621:Ankrd34a UTSW 3 96598215 missense possibly damaging 0.91
R6891:Ankrd34a UTSW 3 96598019 missense probably benign 0.00
R6951:Ankrd34a UTSW 3 96598422 missense possibly damaging 0.77
R7085:Ankrd34a UTSW 3 96598629 missense probably benign
R7478:Ankrd34a UTSW 3 96598500 missense possibly damaging 0.65
R8257:Ankrd34a UTSW 3 96597729 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCGTCATACATCAGGTTCG -3'
(R):5'- CGCCTTGCTCCAAGAGATAG -3'

Sequencing Primer
(F):5'- ATACATCAGGTTCGTTCATCGG -3'
(R):5'- TTGCTCCAAGAGATAGCGTACCATG -3'
Posted On2021-03-08