Incidental Mutation 'R8746:Corin'
ID663544
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R8746 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72435352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000005352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably benign
Transcript: ENSMUST00000005352
AA Change: D234G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: D234G

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167460
AA Change: D168G

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: D168G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175766
AA Change: D166G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: D166G

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176974
AA Change: D168G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: D168G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177290
AA Change: D101G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: D101G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,410 M871K probably benign Het
5530400C23Rik A C 6: 133,294,293 E100A possibly damaging Het
Aatf A T 11: 84,511,512 I116N probably benign Het
Abcb11 G T 2: 69,257,410 probably benign Het
Adarb2 G T 13: 8,752,644 A652S probably benign Het
Adgb C T 10: 10,405,284 probably null Het
Ankrd34a C T 3: 96,597,475 probably benign Het
Ano2 A G 6: 125,863,550 I395V probably benign Het
Cadm2 C A 16: 66,784,809 R203L probably damaging Het
Ccr2 T C 9: 124,106,411 F243L probably benign Het
Ccr4 A G 9: 114,492,850 V49A probably damaging Het
Drd5 G T 5: 38,320,090 R142I probably benign Het
Dsg1b A G 18: 20,395,999 D264G probably damaging Het
Ezh2 T C 6: 47,576,600 K61R probably damaging Het
Frmd4b T A 6: 97,292,409 T981S probably benign Het
Gcg T A 2: 62,474,981 K180N probably damaging Het
Gm10840 G A 11: 106,160,916 E23K unknown Het
Gm2696 T G 10: 77,815,203 C174W unknown Het
Grin2b T C 6: 135,922,987 I299V probably benign Het
Hepacam T A 9: 37,381,734 V207E probably damaging Het
Igf1r T A 7: 68,214,997 M1181K probably damaging Het
Lmo2 T C 2: 103,976,039 S96P possibly damaging Het
Marf1 T A 16: 14,117,304 E1533D probably benign Het
Megf9 A G 4: 70,435,274 C432R probably damaging Het
Mpp2 A G 11: 102,063,214 Y236H probably damaging Het
Neb T C 2: 52,282,601 I1565V probably damaging Het
Olfr1001-ps1 T A 2: 85,633,877 Y149* probably null Het
Olfr1392 A G 11: 49,293,166 probably benign Het
Olfr1469 A G 19: 13,410,728 D53G probably benign Het
Olfr203 T A 16: 59,303,610 F152L probably benign Het
Olfr308 C T 7: 86,321,229 C241Y probably damaging Het
Olfr663 A T 7: 104,703,860 I98F probably damaging Het
Olfr826 T C 10: 130,180,217 Y221C probably damaging Het
Patj T A 4: 98,505,830 probably benign Het
Pknox1 A T 17: 31,590,650 Q76L possibly damaging Het
Plekhg1 C A 10: 3,957,777 T953K Het
Plekhn1 C A 4: 156,232,225 R333L probably damaging Het
Plk5 T A 10: 80,358,776 V111D probably benign Het
Polr1b A G 2: 129,112,677 I398M possibly damaging Het
Ranbp3 T C 17: 56,702,826 V137A probably benign Het
Rc3h1 T A 1: 160,930,174 F21I probably damaging Het
Rgs8 T C 1: 153,671,791 S56P probably damaging Het
Rhpn1 G A 15: 75,713,576 V593M probably damaging Het
Sdad1 A G 5: 92,289,925 S589P probably benign Het
Skp1a A G 11: 52,246,016 K163R probably damaging Het
Slf2 A G 19: 44,973,624 Y1080C probably damaging Het
Tcf4 C T 18: 69,521,501 probably benign Het
Tmem144 C T 3: 79,825,348 V208M probably damaging Het
Tmem2 G A 19: 21,826,101 G833R probably damaging Het
Tomm34 A T 2: 164,060,964 L142Q probably benign Het
Unc13b T A 4: 43,176,120 V2316D unknown Het
Yme1l1 T A 2: 23,162,531 S66T probably benign Het
Zfc3h1 T C 10: 115,407,980 S739P probably damaging Het
Zscan25 T A 5: 145,287,347 V209E possibly damaging Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5268:Corin UTSW 5 72343019 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R7956:Corin UTSW 5 72422187 missense probably damaging 0.99
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
R8125:Corin UTSW 5 72358463 missense probably damaging 0.96
R8215:Corin UTSW 5 72305018 missense probably damaging 1.00
R8251:Corin UTSW 5 72356926 missense probably damaging 1.00
R8364:Corin UTSW 5 72304931 missense probably benign
R8505:Corin UTSW 5 72435407 missense probably benign 0.21
R8887:Corin UTSW 5 72329610 critical splice donor site probably null
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGACAGATGTGGGTCCCTTC -3'
(R):5'- GTCCTTAACCTGGCATGTTATG -3'

Sequencing Primer
(F):5'- AACAGGATGATTTGTCCCTCTTG -3'
(R):5'- CCTGGCATGTTATGTAAGCTTACAG -3'
Posted On2021-03-08