Incidental Mutation 'R8746:Sdad1'
ID 663545
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene Name SDA1 domain containing 1
Synonyms
MMRRC Submission 068590-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R8746 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92431869-92457883 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92437784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 589 (S589P)
Ref Sequence ENSEMBL: ENSMUSP00000031364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031364
AA Change: S589P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: S589P

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201143
AA Change: S588P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: S588P

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,451,529 (GRCm39) M871K probably benign Het
5530400C23Rik A C 6: 133,271,256 (GRCm39) E100A possibly damaging Het
Aatf A T 11: 84,402,338 (GRCm39) I116N probably benign Het
Abcb11 G T 2: 69,087,754 (GRCm39) probably benign Het
Adarb2 G T 13: 8,802,680 (GRCm39) A652S probably benign Het
Adgb C T 10: 10,281,028 (GRCm39) probably null Het
Ankrd34a C T 3: 96,504,791 (GRCm39) probably benign Het
Ano2 A G 6: 125,840,513 (GRCm39) I395V probably benign Het
Cadm2 C A 16: 66,581,696 (GRCm39) R203L probably damaging Het
Ccr2 T C 9: 123,906,448 (GRCm39) F243L probably benign Het
Ccr4 A G 9: 114,321,918 (GRCm39) V49A probably damaging Het
Cemip2 G A 19: 21,803,465 (GRCm39) G833R probably damaging Het
Corin T C 5: 72,592,695 (GRCm39) D234G probably benign Het
Drd5 G T 5: 38,477,433 (GRCm39) R142I probably benign Het
Dsg1b A G 18: 20,529,056 (GRCm39) D264G probably damaging Het
Ezh2 T C 6: 47,553,534 (GRCm39) K61R probably damaging Het
Frmd4b T A 6: 97,269,370 (GRCm39) T981S probably benign Het
Gcg T A 2: 62,305,325 (GRCm39) K180N probably damaging Het
Gm10840 G A 11: 106,051,742 (GRCm39) E23K unknown Het
Gm2696 T G 10: 77,651,037 (GRCm39) C174W unknown Het
Grin2b T C 6: 135,899,985 (GRCm39) I299V probably benign Het
Hepacam T A 9: 37,293,030 (GRCm39) V207E probably damaging Het
Igf1r T A 7: 67,864,745 (GRCm39) M1181K probably damaging Het
Lmo2 T C 2: 103,806,384 (GRCm39) S96P possibly damaging Het
Marf1 T A 16: 13,935,168 (GRCm39) E1533D probably benign Het
Megf9 A G 4: 70,353,511 (GRCm39) C432R probably damaging Het
Mpp2 A G 11: 101,954,040 (GRCm39) Y236H probably damaging Het
Neb T C 2: 52,172,613 (GRCm39) I1565V probably damaging Het
Or2y1f A G 11: 49,183,993 (GRCm39) probably benign Het
Or56b2j A T 7: 104,353,067 (GRCm39) I98F probably damaging Het
Or5ac21 T A 16: 59,123,973 (GRCm39) F152L probably benign Het
Or5b3 A G 19: 13,388,092 (GRCm39) D53G probably benign Het
Or5g24-ps1 T A 2: 85,464,221 (GRCm39) Y149* probably null Het
Or6f1 C T 7: 85,970,437 (GRCm39) C241Y probably damaging Het
Or9k2b T C 10: 130,016,086 (GRCm39) Y221C probably damaging Het
Patj T A 4: 98,394,067 (GRCm39) probably benign Het
Pknox1 A T 17: 31,809,624 (GRCm39) Q76L possibly damaging Het
Plekhg1 C A 10: 3,907,777 (GRCm39) T953K Het
Plekhn1 C A 4: 156,316,682 (GRCm39) R333L probably damaging Het
Plk5 T A 10: 80,194,610 (GRCm39) V111D probably benign Het
Polr1b A G 2: 128,954,597 (GRCm39) I398M possibly damaging Het
Ranbp3 T C 17: 57,009,826 (GRCm39) V137A probably benign Het
Rc3h1 T A 1: 160,757,744 (GRCm39) F21I probably damaging Het
Rgs8 T C 1: 153,547,537 (GRCm39) S56P probably damaging Het
Rhpn1 G A 15: 75,585,425 (GRCm39) V593M probably damaging Het
Skp1 A G 11: 52,136,843 (GRCm39) K163R probably damaging Het
Slf2 A G 19: 44,962,063 (GRCm39) Y1080C probably damaging Het
Tcf4 C T 18: 69,654,572 (GRCm39) probably benign Het
Tmem144 C T 3: 79,732,655 (GRCm39) V208M probably damaging Het
Tomm34 A T 2: 163,902,884 (GRCm39) L142Q probably benign Het
Unc13b T A 4: 43,176,120 (GRCm39) V2316D unknown Het
Yme1l1 T A 2: 23,052,543 (GRCm39) S66T probably benign Het
Zfc3h1 T C 10: 115,243,885 (GRCm39) S739P probably damaging Het
Zscan25 T A 5: 145,224,157 (GRCm39) V209E possibly damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92,451,632 (GRCm39) splice site probably null
IGL01355:Sdad1 APN 5 92,450,538 (GRCm39) missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92,445,019 (GRCm39) missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92,439,621 (GRCm39) missense probably benign 0.03
IGL02503:Sdad1 APN 5 92,449,661 (GRCm39) unclassified probably benign
IGL02739:Sdad1 APN 5 92,437,931 (GRCm39) missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92,439,777 (GRCm39) missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92,452,923 (GRCm39) missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92,446,092 (GRCm39) missense probably benign 0.32
R1496:Sdad1 UTSW 5 92,457,682 (GRCm39) missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92,453,155 (GRCm39) nonsense probably null
R1848:Sdad1 UTSW 5 92,440,510 (GRCm39) critical splice donor site probably null
R2419:Sdad1 UTSW 5 92,453,677 (GRCm39) missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92,447,958 (GRCm39) missense probably benign 0.00
R2509:Sdad1 UTSW 5 92,453,684 (GRCm39) missense probably benign 0.12
R4043:Sdad1 UTSW 5 92,450,553 (GRCm39) missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92,446,116 (GRCm39) missense probably benign 0.01
R4477:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92,445,019 (GRCm39) missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92,452,836 (GRCm39) missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92,451,793 (GRCm39) missense probably benign 0.00
R5288:Sdad1 UTSW 5 92,434,684 (GRCm39) makesense probably null
R6331:Sdad1 UTSW 5 92,451,789 (GRCm39) missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92,446,049 (GRCm39) critical splice donor site probably null
R7099:Sdad1 UTSW 5 92,441,832 (GRCm39) missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92,453,596 (GRCm39) missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92,447,980 (GRCm39) missense probably benign 0.10
R7714:Sdad1 UTSW 5 92,450,538 (GRCm39) missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92,447,948 (GRCm39) missense probably benign 0.01
R8198:Sdad1 UTSW 5 92,439,811 (GRCm39) missense probably damaging 0.96
R8347:Sdad1 UTSW 5 92,446,088 (GRCm39) missense probably benign 0.00
R8693:Sdad1 UTSW 5 92,452,857 (GRCm39) missense probably benign 0.09
R8696:Sdad1 UTSW 5 92,437,645 (GRCm39) missense probably damaging 1.00
R9004:Sdad1 UTSW 5 92,439,820 (GRCm39) missense probably benign 0.00
R9166:Sdad1 UTSW 5 92,446,080 (GRCm39) nonsense probably null
R9732:Sdad1 UTSW 5 92,438,942 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACTCACCATTGCAGTTG -3'
(R):5'- TGGCTGTATGCTTTTCAAGGCC -3'

Sequencing Primer
(F):5'- ACCATTGCAGTTGCTAGTCTCG -3'
(R):5'- TGCTTTTCAAGGCCACGAAG -3'
Posted On 2021-03-08