Mutagenetix > Incidental Mutations

Incidental Mutation 'R8746:Olfr203'

663573

Institutional Source

Beutler Lab

Gene Symbol

Olfr203

Ensembl Gene

ENSMUSG00000068182

Gene Name

olfactory receptor 203

Synonyms

MOR182-5, GA_x54KRFPKG5P-55517445-55518365

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R8746 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59298881-59304413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59303610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 152 (F152L)

Ref Sequence

ENSEMBL: ENSMUSP00000149906 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000215893]

AlphaFold

L7N205

Predicted Effect

probably benign
Transcript: ENSMUST00000089305
AA Change: F153L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: F153L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	307	1e-46	PFAM
Pfam:7tm_1	41	290	7.6e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215893
AA Change: F152L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	A	13: 77,303,410	M871K	probably benign	Het
5530400C23Rik	A	C	6: 133,294,293	E100A	possibly damaging	Het
Aatf	A	T	11: 84,511,512	I116N	probably benign	Het
Abcb11	G	T	2: 69,257,410		probably benign	Het
Adarb2	G	T	13: 8,752,644	A652S	probably benign	Het
Adgb	C	T	10: 10,405,284		probably null	Het
Ankrd34a	C	T	3: 96,597,475		probably benign	Het
Ano2	A	G	6: 125,863,550	I395V	probably benign	Het
Cadm2	C	A	16: 66,784,809	R203L	probably damaging	Het
Ccr2	T	C	9: 124,106,411	F243L	probably benign	Het
Ccr4	A	G	9: 114,492,850	V49A	probably damaging	Het
Corin	T	C	5: 72,435,352	D234G	probably benign	Het
Drd5	G	T	5: 38,320,090	R142I	probably benign	Het
Dsg1b	A	G	18: 20,395,999	D264G	probably damaging	Het
Ezh2	T	C	6: 47,576,600	K61R	probably damaging	Het
Frmd4b	T	A	6: 97,292,409	T981S	probably benign	Het
Gcg	T	A	2: 62,474,981	K180N	probably damaging	Het
Gm10840	G	A	11: 106,160,916	E23K	unknown	Het
Gm2696	T	G	10: 77,815,203	C174W	unknown	Het
Grin2b	T	C	6: 135,922,987	I299V	probably benign	Het
Hepacam	T	A	9: 37,381,734	V207E	probably damaging	Het
Igf1r	T	A	7: 68,214,997	M1181K	probably damaging	Het
Lmo2	T	C	2: 103,976,039	S96P	possibly damaging	Het
Marf1	T	A	16: 14,117,304	E1533D	probably benign	Het
Megf9	A	G	4: 70,435,274	C432R	probably damaging	Het
Mpp2	A	G	11: 102,063,214	Y236H	probably damaging	Het
Neb	T	C	2: 52,282,601	I1565V	probably damaging	Het
Olfr1001-ps1	T	A	2: 85,633,877	Y149*	probably null	Het
Olfr1392	A	G	11: 49,293,166		probably benign	Het
Olfr1469	A	G	19: 13,410,728	D53G	probably benign	Het
Olfr308	C	T	7: 86,321,229	C241Y	probably damaging	Het
Olfr663	A	T	7: 104,703,860	I98F	probably damaging	Het
Olfr826	T	C	10: 130,180,217	Y221C	probably damaging	Het
Patj	T	A	4: 98,505,830		probably benign	Het
Pknox1	A	T	17: 31,590,650	Q76L	possibly damaging	Het
Plekhg1	C	A	10: 3,957,777	T953K		Het
Plekhn1	C	A	4: 156,232,225	R333L	probably damaging	Het
Plk5	T	A	10: 80,358,776	V111D	probably benign	Het
Polr1b	A	G	2: 129,112,677	I398M	possibly damaging	Het
Ranbp3	T	C	17: 56,702,826	V137A	probably benign	Het
Rc3h1	T	A	1: 160,930,174	F21I	probably damaging	Het
Rgs8	T	C	1: 153,671,791	S56P	probably damaging	Het
Rhpn1	G	A	15: 75,713,576	V593M	probably damaging	Het
Sdad1	A	G	5: 92,289,925	S589P	probably benign	Het
Skp1a	A	G	11: 52,246,016	K163R	probably damaging	Het
Slf2	A	G	19: 44,973,624	Y1080C	probably damaging	Het
Tcf4	C	T	18: 69,521,501		probably benign	Het
Tmem144	C	T	3: 79,825,348	V208M	probably damaging	Het
Tmem2	G	A	19: 21,826,101	G833R	probably damaging	Het
Tomm34	A	T	2: 164,060,964	L142Q	probably benign	Het
Unc13b	T	A	4: 43,176,120	V2316D	unknown	Het
Yme1l1	T	A	2: 23,162,531	S66T	probably benign	Het
Zfc3h1	T	C	10: 115,407,980	S739P	probably damaging	Het
Zscan25	T	A	5: 145,287,347	V209E	possibly damaging	Het

Other mutations in Olfr203

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02003:Olfr203	APN	16	59303633	missense	probably damaging	0.99
IGL02294:Olfr203	APN	16	59303612	missense	probably damaging	1.00
IGL02412:Olfr203	APN	16	59303192	missense	probably damaging	1.00
IGL02899:Olfr203	APN	16	59303286	missense	probably damaging	1.00
R0792:Olfr203	UTSW	16	59303989	missense	probably damaging	0.99
R1551:Olfr203	UTSW	16	59303403	missense	probably benign	0.03
R1701:Olfr203	UTSW	16	59303288	missense	probably benign	0.23
R1975:Olfr203	UTSW	16	59303728	missense	probably damaging	0.98
R2272:Olfr203	UTSW	16	59303444	missense	possibly damaging	0.55
R5199:Olfr203	UTSW	16	59303740	missense	probably benign
R5843:Olfr203	UTSW	16	59303361	missense	probably damaging	1.00
R5928:Olfr203	UTSW	16	59303158	missense	probably damaging	1.00
R6708:Olfr203	UTSW	16	59304053	missense	probably damaging	1.00
R6747:Olfr203	UTSW	16	59303641	missense	probably benign	0.03
R6894:Olfr203	UTSW	16	59303779	missense	probably damaging	0.98
R7324:Olfr203	UTSW	16	59303248	missense	probably benign
R7380:Olfr203	UTSW	16	59304028	missense	probably damaging	1.00
R7612:Olfr203	UTSW	16	59303627	missense	probably damaging	1.00
R7775:Olfr203	UTSW	16	59303251	missense	probably damaging	1.00
R8010:Olfr203	UTSW	16	59303504	missense	probably damaging	1.00
R8408:Olfr203	UTSW	16	59304055	nonsense	probably null
R8424:Olfr203	UTSW	16	59303409	missense	possibly damaging	0.60
Z1176:Olfr203	UTSW	16	59303169	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGTGACTCCCAGGATGCTTG -3'
(R):5'- TAACAGCTTGTATCACAGCAGC -3'

Sequencing Primer
(F):5'- GACTCCCAGGATGCTTGTTAATATC -3'
(R):5'- GCTTGTATCACAGCAGCAAAAATG -3'

Posted On

2021-03-08