Incidental Mutation 'R8746:Olfr203'
ID 663573
Institutional Source Beutler Lab
Gene Symbol Olfr203
Ensembl Gene ENSMUSG00000068182
Gene Name olfactory receptor 203
Synonyms MOR182-5, GA_x54KRFPKG5P-55517445-55518365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8746 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59298881-59304413 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59303610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 152 (F152L)
Ref Sequence ENSEMBL: ENSMUSP00000149906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089305] [ENSMUST00000215893]
AlphaFold L7N205
Predicted Effect probably benign
Transcript: ENSMUST00000089305
AA Change: F153L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000086719
Gene: ENSMUSG00000068182
AA Change: F153L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1e-46 PFAM
Pfam:7tm_1 41 290 7.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215893
AA Change: F152L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,410 M871K probably benign Het
5530400C23Rik A C 6: 133,294,293 E100A possibly damaging Het
Aatf A T 11: 84,511,512 I116N probably benign Het
Abcb11 G T 2: 69,257,410 probably benign Het
Adarb2 G T 13: 8,752,644 A652S probably benign Het
Adgb C T 10: 10,405,284 probably null Het
Ankrd34a C T 3: 96,597,475 probably benign Het
Ano2 A G 6: 125,863,550 I395V probably benign Het
Cadm2 C A 16: 66,784,809 R203L probably damaging Het
Ccr2 T C 9: 124,106,411 F243L probably benign Het
Ccr4 A G 9: 114,492,850 V49A probably damaging Het
Corin T C 5: 72,435,352 D234G probably benign Het
Drd5 G T 5: 38,320,090 R142I probably benign Het
Dsg1b A G 18: 20,395,999 D264G probably damaging Het
Ezh2 T C 6: 47,576,600 K61R probably damaging Het
Frmd4b T A 6: 97,292,409 T981S probably benign Het
Gcg T A 2: 62,474,981 K180N probably damaging Het
Gm10840 G A 11: 106,160,916 E23K unknown Het
Gm2696 T G 10: 77,815,203 C174W unknown Het
Grin2b T C 6: 135,922,987 I299V probably benign Het
Hepacam T A 9: 37,381,734 V207E probably damaging Het
Igf1r T A 7: 68,214,997 M1181K probably damaging Het
Lmo2 T C 2: 103,976,039 S96P possibly damaging Het
Marf1 T A 16: 14,117,304 E1533D probably benign Het
Megf9 A G 4: 70,435,274 C432R probably damaging Het
Mpp2 A G 11: 102,063,214 Y236H probably damaging Het
Neb T C 2: 52,282,601 I1565V probably damaging Het
Olfr1001-ps1 T A 2: 85,633,877 Y149* probably null Het
Olfr1392 A G 11: 49,293,166 probably benign Het
Olfr1469 A G 19: 13,410,728 D53G probably benign Het
Olfr308 C T 7: 86,321,229 C241Y probably damaging Het
Olfr663 A T 7: 104,703,860 I98F probably damaging Het
Olfr826 T C 10: 130,180,217 Y221C probably damaging Het
Patj T A 4: 98,505,830 probably benign Het
Pknox1 A T 17: 31,590,650 Q76L possibly damaging Het
Plekhg1 C A 10: 3,957,777 T953K Het
Plekhn1 C A 4: 156,232,225 R333L probably damaging Het
Plk5 T A 10: 80,358,776 V111D probably benign Het
Polr1b A G 2: 129,112,677 I398M possibly damaging Het
Ranbp3 T C 17: 56,702,826 V137A probably benign Het
Rc3h1 T A 1: 160,930,174 F21I probably damaging Het
Rgs8 T C 1: 153,671,791 S56P probably damaging Het
Rhpn1 G A 15: 75,713,576 V593M probably damaging Het
Sdad1 A G 5: 92,289,925 S589P probably benign Het
Skp1a A G 11: 52,246,016 K163R probably damaging Het
Slf2 A G 19: 44,973,624 Y1080C probably damaging Het
Tcf4 C T 18: 69,521,501 probably benign Het
Tmem144 C T 3: 79,825,348 V208M probably damaging Het
Tmem2 G A 19: 21,826,101 G833R probably damaging Het
Tomm34 A T 2: 164,060,964 L142Q probably benign Het
Unc13b T A 4: 43,176,120 V2316D unknown Het
Yme1l1 T A 2: 23,162,531 S66T probably benign Het
Zfc3h1 T C 10: 115,407,980 S739P probably damaging Het
Zscan25 T A 5: 145,287,347 V209E possibly damaging Het
Other mutations in Olfr203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Olfr203 APN 16 59303633 missense probably damaging 0.99
IGL02294:Olfr203 APN 16 59303612 missense probably damaging 1.00
IGL02412:Olfr203 APN 16 59303192 missense probably damaging 1.00
IGL02899:Olfr203 APN 16 59303286 missense probably damaging 1.00
R0792:Olfr203 UTSW 16 59303989 missense probably damaging 0.99
R1551:Olfr203 UTSW 16 59303403 missense probably benign 0.03
R1701:Olfr203 UTSW 16 59303288 missense probably benign 0.23
R1975:Olfr203 UTSW 16 59303728 missense probably damaging 0.98
R2272:Olfr203 UTSW 16 59303444 missense possibly damaging 0.55
R5199:Olfr203 UTSW 16 59303740 missense probably benign
R5843:Olfr203 UTSW 16 59303361 missense probably damaging 1.00
R5928:Olfr203 UTSW 16 59303158 missense probably damaging 1.00
R6708:Olfr203 UTSW 16 59304053 missense probably damaging 1.00
R6747:Olfr203 UTSW 16 59303641 missense probably benign 0.03
R6894:Olfr203 UTSW 16 59303779 missense probably damaging 0.98
R7324:Olfr203 UTSW 16 59303248 missense probably benign
R7380:Olfr203 UTSW 16 59304028 missense probably damaging 1.00
R7612:Olfr203 UTSW 16 59303627 missense probably damaging 1.00
R7775:Olfr203 UTSW 16 59303251 missense probably damaging 1.00
R8010:Olfr203 UTSW 16 59303504 missense probably damaging 1.00
R8408:Olfr203 UTSW 16 59304055 nonsense probably null
R8424:Olfr203 UTSW 16 59303409 missense possibly damaging 0.60
Z1176:Olfr203 UTSW 16 59303169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGACTCCCAGGATGCTTG -3'
(R):5'- TAACAGCTTGTATCACAGCAGC -3'

Sequencing Primer
(F):5'- GACTCCCAGGATGCTTGTTAATATC -3'
(R):5'- GCTTGTATCACAGCAGCAAAAATG -3'
Posted On 2021-03-08