Mutagenetix > Incidental Mutations

Incidental Mutation 'R8747:Nbn'

663587

Institutional Source

Beutler Lab

Gene Symbol

Nbn

Ensembl Gene

ENSMUSG00000028224

Gene Name

nibrin

Synonyms

Nbs1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8747 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15957925-15992589 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 15981555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Isoleucine at position 549 (R549I)

Ref Sequence

ENSEMBL: ENSMUSP00000029879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]

AlphaFold

Q9R207

Predicted Effect

probably damaging
Transcript: ENSMUST00000029879
AA Change: R549I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: R549I

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
FHA	23	83	2.27e-4	SMART
BRCT	103	184	6.37e0	SMART
Pfam:NIBRIN_BRCT_II	216	325	2.2e-34	PFAM
low complexity region	557	565	N/A	INTRINSIC
Nbs1_C	680	744	2.14e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149069

SMART Domains

Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
FHA	23	83	2.27e-4	SMART
BRCT	103	184	6.37e0	SMART
PDB:2K2W\|A	217	326	3e-32	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,582,240	D190G	probably benign	Het
8430408G22Rik	T	A	6: 116,652,161	L155Q	possibly damaging	Het
Abhd11	A	G	5: 135,011,906	I271V	possibly damaging	Het
AI314180	C	T	4: 58,828,632	V934I	probably damaging	Het
Akap6	T	G	12: 53,142,216	S2138A	probably benign	Het
Amn	C	A	12: 111,275,006	P235H	probably damaging	Het
Arf2	A	T	11: 103,969,149	M18L	probably benign	Het
Asic2	A	T	11: 81,152,407	F20Y	possibly damaging	Het
Bok	T	C	1: 93,694,942		probably null	Het
Cachd1	T	A	4: 101,002,848		probably benign	Het
Casp8	A	G	1: 58,844,458	N308S	probably benign	Het
Cavin3	G	T	7: 105,481,947	H71Q	possibly damaging	Het
Ccdc87	A	G	19: 4,841,618	I713V	probably benign	Het
Clcn6	A	T	4: 148,008,897		probably null	Het
Cmas	T	C	6: 142,771,201	I273T	possibly damaging	Het
Ctxn3	A	T	18: 57,477,306	D65V	probably damaging	Het
D130040H23Rik	C	A	8: 69,303,053	N387K	probably benign	Het
Dnah9	T	C	11: 65,927,990	K3174R	possibly damaging	Het
Efcab14	A	G	4: 115,746,596	N157S	probably damaging	Het
Ets1	G	A	9: 32,730,178	G109D	probably damaging	Het
Fbln5	G	A	12: 101,768,495	R173C	probably damaging	Het
Fchsd1	G	A	18: 37,962,982	P525L	probably benign	Het
Gmppa	G	A	1: 75,439,381	V156I	probably damaging	Het
Gtpbp1	A	G	15: 79,719,281	D182G		Het
Ift140	T	A	17: 25,035,835	S430T	probably benign	Het
Kat7	G	C	11: 95,294,566	C161W	probably damaging	Het
Lipk	T	A	19: 34,018,784	M32K	probably damaging	Het
Lum	A	T	10: 97,568,489	D82V	possibly damaging	Het
Macf1	C	A	4: 123,355,151	A7196S	probably damaging	Het
Mroh2b	T	A	15: 4,935,300	S926T	probably damaging	Het
Nfu1	T	C	6: 87,019,418	I117T	probably damaging	Het
Olfr1355	A	G	10: 78,879,321	T50A	probably benign	Het
Olfr566	T	C	7: 102,856,932	T117A	probably benign	Het
Parp1	T	C	1: 180,594,710	L778P	probably damaging	Het
Pbld2	G	T	10: 63,052,290	V125F	probably benign	Het
Prkag2	A	G	5: 24,880,682		probably null	Het
Prss54	A	G	8: 95,559,723	F241L	probably benign	Het
Rnf121	T	C	7: 102,029,109	D177G	probably damaging	Het
Slc12a7	G	A	13: 73,785,122	V100I	probably benign	Het
Slc28a1	C	T	7: 81,124,971	L189F	possibly damaging	Het
Slc35a3	T	C	3: 116,694,570	Q16R	probably damaging	Het
Snap91	A	G	9: 86,804,524	F354L	probably damaging	Het
Steap2	A	G	5: 5,673,539	I447T	probably benign	Het
Tagap	T	A	17: 7,928,770	I104N	probably damaging	Het
Tas1r2	A	G	4: 139,660,007	D259G	probably benign	Het
Tgm3	T	C	2: 130,044,532	S558P	probably benign	Het
Tuba3a	A	G	6: 125,281,055	V324A	probably damaging	Het
Vmn1r238	T	G	18: 3,123,232	I61L	possibly damaging	Het
Vmn1r52	A	G	6: 90,179,469	T252A	probably benign	Het
Vmp1	A	G	11: 86,602,059	V308A	probably damaging	Het
Wdfy4	A	C	14: 33,152,654	V159G		Het
Zfp180	A	G	7: 24,105,262	T369A	possibly damaging	Het
Zfp827	A	G	8: 79,028,687	M1V	probably null	Het
Zmym4	A	G	4: 126,893,405	I1031T	probably damaging	Het

Other mutations in Nbn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Nbn	APN	4	15964320	missense	probably benign	0.01
IGL00921:Nbn	APN	4	15963833	missense	possibly damaging	0.85
IGL01621:Nbn	APN	4	15965221	missense	probably benign	0.45
IGL02372:Nbn	APN	4	15986613	missense	probably benign	0.00
IGL03392:Nbn	APN	4	15962362	missense	probably damaging	1.00
nebish	UTSW	4	15965132	critical splice acceptor site	probably null
zenobia	UTSW	4	15969391	missense	probably damaging	1.00
R0238:Nbn	UTSW	4	15986672	splice site	probably benign
R0244:Nbn	UTSW	4	15979353	missense	probably benign	0.00
R0432:Nbn	UTSW	4	15983951	unclassified	probably benign
R0946:Nbn	UTSW	4	15970719	critical splice acceptor site	probably null
R1076:Nbn	UTSW	4	15970719	critical splice acceptor site	probably null
R1563:Nbn	UTSW	4	15981668	missense	possibly damaging	0.77
R1579:Nbn	UTSW	4	15964289	missense	probably damaging	0.99
R1660:Nbn	UTSW	4	15971771	missense	probably benign	0.06
R1663:Nbn	UTSW	4	15970903	missense	probably benign	0.13
R2005:Nbn	UTSW	4	15979351	missense	probably benign	0.01
R2010:Nbn	UTSW	4	15969393	missense	probably damaging	1.00
R2077:Nbn	UTSW	4	15979389	missense	probably damaging	1.00
R2228:Nbn	UTSW	4	15970904	missense	probably benign	0.01
R2229:Nbn	UTSW	4	15970904	missense	probably benign	0.01
R2356:Nbn	UTSW	4	15970863	missense	probably damaging	0.96
R2869:Nbn	UTSW	4	15963810	missense	probably damaging	1.00
R2869:Nbn	UTSW	4	15963810	missense	probably damaging	1.00
R3508:Nbn	UTSW	4	15962387	missense	probably damaging	1.00
R3745:Nbn	UTSW	4	15976163	missense	possibly damaging	0.67
R3753:Nbn	UTSW	4	15964269	missense	probably damaging	0.98
R4756:Nbn	UTSW	4	15981470	missense	probably benign	0.00
R5042:Nbn	UTSW	4	15981446	missense	probably benign	0.10
R5177:Nbn	UTSW	4	15965132	critical splice acceptor site	probably null
R5229:Nbn	UTSW	4	15963893	missense	probably damaging	0.98
R5368:Nbn	UTSW	4	15969391	missense	probably damaging	1.00
R5431:Nbn	UTSW	4	15986593	missense	probably benign
R6025:Nbn	UTSW	4	15981347	missense	probably damaging	0.97
R6375:Nbn	UTSW	4	15979327	missense	probably benign
R6543:Nbn	UTSW	4	15986605	missense	probably benign	0.39
R6655:Nbn	UTSW	4	15981696	missense	probably damaging	0.98
R6965:Nbn	UTSW	4	15970863	missense	probably benign	0.25
R7090:Nbn	UTSW	4	15981350	missense	probably benign	0.06
R7159:Nbn	UTSW	4	15983677	splice site	probably null
R7241:Nbn	UTSW	4	15991190	missense	probably benign	0.00
R7267:Nbn	UTSW	4	15979320	missense	probably benign	0.00
R7597:Nbn	UTSW	4	15963911	missense	probably damaging	1.00
R7937:Nbn	UTSW	4	15958080	missense	probably damaging	0.99
R8110:Nbn	UTSW	4	15981588	missense	probably benign	0.02
R8317:Nbn	UTSW	4	15970893	missense	probably damaging	0.96
R8327:Nbn	UTSW	4	15981470	missense	probably benign	0.00
R8725:Nbn	UTSW	4	15963911	missense	probably damaging	1.00
R8727:Nbn	UTSW	4	15963911	missense	probably damaging	1.00
R8909:Nbn	UTSW	4	15970833	missense	probably damaging	1.00
R8973:Nbn	UTSW	4	15986585	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAGCTGTCCTCGTGCAAATC -3'
(R):5'- TCTGATCCACCATTCAGGGG -3'

Sequencing Primer
(F):5'- CTCGTGCAAATCATCCAGGATGG -3'
(R):5'- ACCATTCAGGGGCCGATTC -3'

Posted On

2021-03-08