Incidental Mutation 'R8747:Nbn'
ID 663587
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Name nibrin
Synonyms Nbs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8747 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 15957925-15992589 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 15981555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Isoleucine at position 549 (R549I)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
AlphaFold Q9R207
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: R549I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: R549I

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149069
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,240 D190G probably benign Het
8430408G22Rik T A 6: 116,652,161 L155Q possibly damaging Het
Abhd11 A G 5: 135,011,906 I271V possibly damaging Het
AI314180 C T 4: 58,828,632 V934I probably damaging Het
Akap6 T G 12: 53,142,216 S2138A probably benign Het
Amn C A 12: 111,275,006 P235H probably damaging Het
Arf2 A T 11: 103,969,149 M18L probably benign Het
Asic2 A T 11: 81,152,407 F20Y possibly damaging Het
Bok T C 1: 93,694,942 probably null Het
Cachd1 T A 4: 101,002,848 probably benign Het
Casp8 A G 1: 58,844,458 N308S probably benign Het
Cavin3 G T 7: 105,481,947 H71Q possibly damaging Het
Ccdc87 A G 19: 4,841,618 I713V probably benign Het
Clcn6 A T 4: 148,008,897 probably null Het
Cmas T C 6: 142,771,201 I273T possibly damaging Het
Ctxn3 A T 18: 57,477,306 D65V probably damaging Het
D130040H23Rik C A 8: 69,303,053 N387K probably benign Het
Dnah9 T C 11: 65,927,990 K3174R possibly damaging Het
Efcab14 A G 4: 115,746,596 N157S probably damaging Het
Ets1 G A 9: 32,730,178 G109D probably damaging Het
Fbln5 G A 12: 101,768,495 R173C probably damaging Het
Fchsd1 G A 18: 37,962,982 P525L probably benign Het
Gmppa G A 1: 75,439,381 V156I probably damaging Het
Gtpbp1 A G 15: 79,719,281 D182G Het
Ift140 T A 17: 25,035,835 S430T probably benign Het
Kat7 G C 11: 95,294,566 C161W probably damaging Het
Lipk T A 19: 34,018,784 M32K probably damaging Het
Lum A T 10: 97,568,489 D82V possibly damaging Het
Macf1 C A 4: 123,355,151 A7196S probably damaging Het
Mroh2b T A 15: 4,935,300 S926T probably damaging Het
Nfu1 T C 6: 87,019,418 I117T probably damaging Het
Olfr1355 A G 10: 78,879,321 T50A probably benign Het
Olfr566 T C 7: 102,856,932 T117A probably benign Het
Parp1 T C 1: 180,594,710 L778P probably damaging Het
Pbld2 G T 10: 63,052,290 V125F probably benign Het
Prkag2 A G 5: 24,880,682 probably null Het
Prss54 A G 8: 95,559,723 F241L probably benign Het
Rnf121 T C 7: 102,029,109 D177G probably damaging Het
Slc12a7 G A 13: 73,785,122 V100I probably benign Het
Slc28a1 C T 7: 81,124,971 L189F possibly damaging Het
Slc35a3 T C 3: 116,694,570 Q16R probably damaging Het
Snap91 A G 9: 86,804,524 F354L probably damaging Het
Steap2 A G 5: 5,673,539 I447T probably benign Het
Tagap T A 17: 7,928,770 I104N probably damaging Het
Tas1r2 A G 4: 139,660,007 D259G probably benign Het
Tgm3 T C 2: 130,044,532 S558P probably benign Het
Tuba3a A G 6: 125,281,055 V324A probably damaging Het
Vmn1r238 T G 18: 3,123,232 I61L possibly damaging Het
Vmn1r52 A G 6: 90,179,469 T252A probably benign Het
Vmp1 A G 11: 86,602,059 V308A probably damaging Het
Wdfy4 A C 14: 33,152,654 V159G Het
Zfp180 A G 7: 24,105,262 T369A possibly damaging Het
Zfp827 A G 8: 79,028,687 M1V probably null Het
Zmym4 A G 4: 126,893,405 I1031T probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
nebish UTSW 4 15965132 critical splice acceptor site probably null
zenobia UTSW 4 15969391 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.00
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 splice site probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
R7937:Nbn UTSW 4 15958080 missense probably damaging 0.99
R8110:Nbn UTSW 4 15981588 missense probably benign 0.02
R8317:Nbn UTSW 4 15970893 missense probably damaging 0.96
R8327:Nbn UTSW 4 15981470 missense probably benign 0.00
R8725:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8727:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8909:Nbn UTSW 4 15970833 missense probably damaging 1.00
R8973:Nbn UTSW 4 15986585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTGTCCTCGTGCAAATC -3'
(R):5'- TCTGATCCACCATTCAGGGG -3'

Sequencing Primer
(F):5'- CTCGTGCAAATCATCCAGGATGG -3'
(R):5'- ACCATTCAGGGGCCGATTC -3'
Posted On 2021-03-08