Incidental Mutation 'R8747:Vmn1r52'
ID663599
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8747 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90179469 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000078760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: T252A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: T252A

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: T252A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227100
AA Change: T52A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227578
AA Change: T73A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: T252A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228385
AA Change: T64A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: T252A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: T252A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,240 D190G probably benign Het
8430408G22Rik T A 6: 116,652,161 L155Q possibly damaging Het
Abhd11 A G 5: 135,011,906 I271V possibly damaging Het
AI314180 C T 4: 58,828,632 V934I probably damaging Het
Akap6 T G 12: 53,142,216 S2138A probably benign Het
Amn C A 12: 111,275,006 P235H probably damaging Het
Arf2 A T 11: 103,969,149 M18L probably benign Het
Bok T C 1: 93,694,942 probably null Het
Casp8 A G 1: 58,844,458 N308S probably benign Het
Cavin3 G T 7: 105,481,947 H71Q possibly damaging Het
Ccdc87 A G 19: 4,841,618 I713V probably benign Het
Clcn6 A T 4: 148,008,897 probably null Het
Cmas T C 6: 142,771,201 I273T possibly damaging Het
Ctxn3 A T 18: 57,477,306 D65V probably damaging Het
D130040H23Rik C A 8: 69,303,053 N387K probably benign Het
Dnah9 T C 11: 65,927,990 K3174R possibly damaging Het
Efcab14 A G 4: 115,746,596 N157S probably damaging Het
Ets1 G A 9: 32,730,178 G109D probably damaging Het
Fbln5 G A 12: 101,768,495 R173C probably damaging Het
Fchsd1 G A 18: 37,962,982 P525L probably benign Het
Gmppa G A 1: 75,439,381 V156I probably damaging Het
Gtpbp1 A G 15: 79,719,281 D182G Het
Ift140 T A 17: 25,035,835 S430T probably benign Het
Kat7 G C 11: 95,294,566 C161W probably damaging Het
Lipk T A 19: 34,018,784 M32K probably damaging Het
Lum A T 10: 97,568,489 D82V possibly damaging Het
Macf1 C A 4: 123,355,151 A7196S probably damaging Het
Mroh2b T A 15: 4,935,300 S926T probably damaging Het
Nbn G T 4: 15,981,555 R549I probably damaging Het
Nfu1 T C 6: 87,019,418 I117T probably damaging Het
Olfr1355 A G 10: 78,879,321 T50A probably benign Het
Olfr566 T C 7: 102,856,932 T117A probably benign Het
Parp1 T C 1: 180,594,710 L778P probably damaging Het
Pbld2 G T 10: 63,052,290 V125F probably benign Het
Prkag2 A G 5: 24,880,682 probably null Het
Prss54 A G 8: 95,559,723 F241L probably benign Het
Rnf121 T C 7: 102,029,109 D177G probably damaging Het
Slc12a7 G A 13: 73,785,122 V100I probably benign Het
Slc28a1 C T 7: 81,124,971 L189F possibly damaging Het
Slc35a3 T C 3: 116,694,570 Q16R probably damaging Het
Snap91 A G 9: 86,804,524 F354L probably damaging Het
Steap2 A G 5: 5,673,539 I447T probably benign Het
Tagap T A 17: 7,928,770 I104N probably damaging Het
Tas1r2 A G 4: 139,660,007 D259G probably benign Het
Tgm3 T C 2: 130,044,532 S558P probably benign Het
Tuba3a A G 6: 125,281,055 V324A probably damaging Het
Vmn1r238 T G 18: 3,123,232 I61L possibly damaging Het
Vmp1 A G 11: 86,602,059 V308A probably damaging Het
Wdfy4 A C 14: 33,152,654 V159G Het
Zfp827 A G 8: 79,028,687 M1V probably null Het
Zmym4 A G 4: 126,893,405 I1031T probably damaging Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90179237 missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90178912 missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90179194 missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90179623 missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90179257 missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCACACTGTTGGCTTTCAGG -3'
(R):5'- TGTGAGAAAACTTACCCTCACAG -3'

Sequencing Primer
(F):5'- CACACTGTTGGCTTTCAGGAATGTC -3'
(R):5'- TTACCCTCACAGAAAATCAAAGTAC -3'
Posted On2021-03-08