Incidental Mutation 'R8747:Slc12a7'
ID 663622
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Name solute carrier family 12, member 7
Synonyms Kcc4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8747 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 73733094-73816754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73785122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 100 (V100I)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900] [ENSMUST00000220535]
AlphaFold Q9WVL3
Predicted Effect probably benign
Transcript: ENSMUST00000017900
AA Change: V100I

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: V100I

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220535
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,582,240 D190G probably benign Het
8430408G22Rik T A 6: 116,652,161 L155Q possibly damaging Het
Abhd11 A G 5: 135,011,906 I271V possibly damaging Het
AI314180 C T 4: 58,828,632 V934I probably damaging Het
Akap6 T G 12: 53,142,216 S2138A probably benign Het
Amn C A 12: 111,275,006 P235H probably damaging Het
Arf2 A T 11: 103,969,149 M18L probably benign Het
Asic2 A T 11: 81,152,407 F20Y possibly damaging Het
Bok T C 1: 93,694,942 probably null Het
Cachd1 T A 4: 101,002,848 probably benign Het
Casp8 A G 1: 58,844,458 N308S probably benign Het
Cavin3 G T 7: 105,481,947 H71Q possibly damaging Het
Ccdc87 A G 19: 4,841,618 I713V probably benign Het
Clcn6 A T 4: 148,008,897 probably null Het
Cmas T C 6: 142,771,201 I273T possibly damaging Het
Ctxn3 A T 18: 57,477,306 D65V probably damaging Het
D130040H23Rik C A 8: 69,303,053 N387K probably benign Het
Dnah9 T C 11: 65,927,990 K3174R possibly damaging Het
Efcab14 A G 4: 115,746,596 N157S probably damaging Het
Ets1 G A 9: 32,730,178 G109D probably damaging Het
Fbln5 G A 12: 101,768,495 R173C probably damaging Het
Fchsd1 G A 18: 37,962,982 P525L probably benign Het
Gmppa G A 1: 75,439,381 V156I probably damaging Het
Gtpbp1 A G 15: 79,719,281 D182G Het
Ift140 T A 17: 25,035,835 S430T probably benign Het
Kat7 G C 11: 95,294,566 C161W probably damaging Het
Lipk T A 19: 34,018,784 M32K probably damaging Het
Lum A T 10: 97,568,489 D82V possibly damaging Het
Macf1 C A 4: 123,355,151 A7196S probably damaging Het
Mroh2b T A 15: 4,935,300 S926T probably damaging Het
Nbn G T 4: 15,981,555 R549I probably damaging Het
Nfu1 T C 6: 87,019,418 I117T probably damaging Het
Olfr1355 A G 10: 78,879,321 T50A probably benign Het
Olfr566 T C 7: 102,856,932 T117A probably benign Het
Parp1 T C 1: 180,594,710 L778P probably damaging Het
Pbld2 G T 10: 63,052,290 V125F probably benign Het
Prkag2 A G 5: 24,880,682 probably null Het
Prss54 A G 8: 95,559,723 F241L probably benign Het
Rnf121 T C 7: 102,029,109 D177G probably damaging Het
Slc28a1 C T 7: 81,124,971 L189F possibly damaging Het
Slc35a3 T C 3: 116,694,570 Q16R probably damaging Het
Snap91 A G 9: 86,804,524 F354L probably damaging Het
Steap2 A G 5: 5,673,539 I447T probably benign Het
Tagap T A 17: 7,928,770 I104N probably damaging Het
Tas1r2 A G 4: 139,660,007 D259G probably benign Het
Tgm3 T C 2: 130,044,532 S558P probably benign Het
Tuba3a A G 6: 125,281,055 V324A probably damaging Het
Vmn1r238 T G 18: 3,123,232 I61L possibly damaging Het
Vmn1r52 A G 6: 90,179,469 T252A probably benign Het
Vmp1 A G 11: 86,602,059 V308A probably damaging Het
Wdfy4 A C 14: 33,152,654 V159G Het
Zfp180 A G 7: 24,105,262 T369A possibly damaging Het
Zfp827 A G 8: 79,028,687 M1V probably null Het
Zmym4 A G 4: 126,893,405 I1031T probably damaging Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73790677 missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73785162 missense probably benign
R8920:Slc12a7 UTSW 13 73798449 missense probably damaging 1.00
R9292:Slc12a7 UTSW 13 73784588 missense possibly damaging 0.46
R9381:Slc12a7 UTSW 13 73800944 missense probably benign 0.00
R9400:Slc12a7 UTSW 13 73784570 missense probably benign 0.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTGGGCTCTTGAGCTCTAC -3'
(R):5'- ACCTTGTCCCTTCCCAGAAG -3'

Sequencing Primer
(F):5'- GGCTCTTGAGCTCTACACAGC -3'
(R):5'- TGTCCACTGAGACACGGTAC -3'
Posted On 2021-03-08